Miyakogusa Predicted Gene

Lj4g3v1389230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1389230.1 tr|Q42061|Q42061_ARATH Ribosomal protein PO
(Fragment) OS=Arabidopsis thaliana PE=2
SV=1,62.32,1e-17,Ribosomal_L10,Ribosomal protein L10/acidic P0; 60S
ACIDIC RIBOSOMAL PROTEIN FAMILY MEMBER,NULL,CUFF.49161.1
         (566 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66594 similar to UniRef100_A7Q3E0 Cluster: 60S acidic...   813   0.0  
gnl|LJGI|TC67978 homologue to UniRef100_P50346 Cluster: 60S acid...    58   6e-08

>gnl|LJGI|TC66594 similar to UniRef100_A7Q3E0 Cluster: 60S acidic ribosomal protein
           P0; n=1; Vitis vinifera|Rep: 60S acidic ribosomal
           protein P0 - Vitis vinifera (Grape), partial (31%)
          Length = 874

 Score =  813 bits (410), Expect = 0.0
 Identities = 527/566 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcggggaaggtgtcgaaggcagcttacgattcgaagatgtgtaagcttcttcgagag 60
           |||||||||||||||||||||||||| |||||| |||||||||| |||||||| ||||||
Sbjct: 35  atggcggggaaggtgtcgaaggcagcatacgatgcgaagatgtggaagcttctacgagag 94

                                                                       
Query: 61  tacagccaggtgctggtggtttccgcagacaatgttgggtcgaaccagcttcaggggata 120
           ||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 95  tacagccaggtgctggtggtttcagcggacaacgttgggtcgaaccagcttcaggggata 154

                                                                       
Query: 121 cggagggcactccacggtgattcggtggtggtgatgggaaagaactcgttgatgaaacgt 180
           |||||||| || |||||||| || |||||||||||||| |||||| |||||||||| || 
Sbjct: 155 cggagggcgctgcacggtgactccgtggtggtgatggggaagaacacgttgatgaagcgc 214

                                                                       
Query: 181 tctatcattgacgatgcagagaaaacaggcaacaaggccttccttaaccttgttcccctc 240
           |||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |||
Sbjct: 215 tctatcattgacgatgcagagaaaactggcaacaaggccttcctcaacctcgttcctctc 274

                                                                       
Query: 241 ctcgtcgggaacgtggctttgattttcaccaaaggtgacttaagggaggtcagcgaacag 300
           || || ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 275 cttgtggggaacgtggcgttgattttcaccaaaggtgacttgagggaggttagcgaacag 334

                                                                       
Query: 301 gttgcaaagtacaaggttgttgatcctattctcatgtgccctaagtacatgacctacgac 360
            |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 335 attgcaaagtacaaggtcgttgatcctattctcatgtgccctaagtacatgacatacgac 394

                                                                       
Query: 361 tcataccgcacttgttcctatttgcaatctggacaattaccgctaggcctcacttgttgt 420
           ||||||||||||||||||||||||||||| |||||||||||  |||||||||| ||||||
Sbjct: 395 tcataccgcacttgttcctatttgcaatcaggacaattacccttaggcctcacgtgttgt 454

                                                                       
Query: 421 aaccagcaatctgcacagacttccgagccttttctagtatgctcaaaatttttgccgcac 480
           |||||||||||| |||||||||| ||||||||||| ||  |||||||||| ||||| |||
Sbjct: 455 aaccagcaatctacacagacttcagagccttttctggtcagctcaaaattcttgccacac 514

                                                                       
Query: 481 cagcattgtcatttgatgagatcaagacagtttttgatgaccagtatatgggctcctttt 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 515 cagcattgtcatttgatgagatcaagacagtttttgatgaccagtatatgggcacctttt 574

                                     
Query: 541 ctccttttggctggtaacttgtgatg 566
           ||||||||||||||||||||||||||
Sbjct: 575 ctccttttggctggtaacttgtgatg 600


>gnl|LJGI|TC67978 homologue to UniRef100_P50346 Cluster: 60S acidic ribosomal protein
           P0; n=1; Glycine max|Rep: 60S acidic ribosomal protein
           P0 - Glycine max (Soybean), partial (97%)
          Length = 1416

 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 259 ttgattttcaccaaaggtgacttaagggaggtcagcgaacaggttgcaaagtacaaggtt 318
           ||||| ||||| ||||||||||| | |||||| |||||  ||||||| ||||||||||||
Sbjct: 403 ttgatcttcacaaaaggtgacttgaaggaggttagcgaggaggttgctaagtacaaggtt 462

            
Query: 319 g 319
           |
Sbjct: 463 g 463