Miyakogusa Predicted Gene
- Lj4g3v1389230.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1389230.1 tr|Q42061|Q42061_ARATH Ribosomal protein PO
(Fragment) OS=Arabidopsis thaliana PE=2
SV=1,62.32,1e-17,Ribosomal_L10,Ribosomal protein L10/acidic P0; 60S
ACIDIC RIBOSOMAL PROTEIN FAMILY MEMBER,NULL,CUFF.49161.1
(566 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66594 similar to UniRef100_A7Q3E0 Cluster: 60S acidic... 813 0.0
gnl|LJGI|TC67978 homologue to UniRef100_P50346 Cluster: 60S acid... 58 6e-08
>gnl|LJGI|TC66594 similar to UniRef100_A7Q3E0 Cluster: 60S acidic ribosomal protein
P0; n=1; Vitis vinifera|Rep: 60S acidic ribosomal
protein P0 - Vitis vinifera (Grape), partial (31%)
Length = 874
Score = 813 bits (410), Expect = 0.0
Identities = 527/566 (93%)
Strand = Plus / Plus
Query: 1 atggcggggaaggtgtcgaaggcagcttacgattcgaagatgtgtaagcttcttcgagag 60
|||||||||||||||||||||||||| |||||| |||||||||| |||||||| ||||||
Sbjct: 35 atggcggggaaggtgtcgaaggcagcatacgatgcgaagatgtggaagcttctacgagag 94
Query: 61 tacagccaggtgctggtggtttccgcagacaatgttgggtcgaaccagcttcaggggata 120
||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 95 tacagccaggtgctggtggtttcagcggacaacgttgggtcgaaccagcttcaggggata 154
Query: 121 cggagggcactccacggtgattcggtggtggtgatgggaaagaactcgttgatgaaacgt 180
|||||||| || |||||||| || |||||||||||||| |||||| |||||||||| ||
Sbjct: 155 cggagggcgctgcacggtgactccgtggtggtgatggggaagaacacgttgatgaagcgc 214
Query: 181 tctatcattgacgatgcagagaaaacaggcaacaaggccttccttaaccttgttcccctc 240
|||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |||
Sbjct: 215 tctatcattgacgatgcagagaaaactggcaacaaggccttcctcaacctcgttcctctc 274
Query: 241 ctcgtcgggaacgtggctttgattttcaccaaaggtgacttaagggaggtcagcgaacag 300
|| || ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 275 cttgtggggaacgtggcgttgattttcaccaaaggtgacttgagggaggttagcgaacag 334
Query: 301 gttgcaaagtacaaggttgttgatcctattctcatgtgccctaagtacatgacctacgac 360
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 335 attgcaaagtacaaggtcgttgatcctattctcatgtgccctaagtacatgacatacgac 394
Query: 361 tcataccgcacttgttcctatttgcaatctggacaattaccgctaggcctcacttgttgt 420
||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||
Sbjct: 395 tcataccgcacttgttcctatttgcaatcaggacaattacccttaggcctcacgtgttgt 454
Query: 421 aaccagcaatctgcacagacttccgagccttttctagtatgctcaaaatttttgccgcac 480
|||||||||||| |||||||||| ||||||||||| || |||||||||| ||||| |||
Sbjct: 455 aaccagcaatctacacagacttcagagccttttctggtcagctcaaaattcttgccacac 514
Query: 481 cagcattgtcatttgatgagatcaagacagtttttgatgaccagtatatgggctcctttt 540
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 515 cagcattgtcatttgatgagatcaagacagtttttgatgaccagtatatgggcacctttt 574
Query: 541 ctccttttggctggtaacttgtgatg 566
||||||||||||||||||||||||||
Sbjct: 575 ctccttttggctggtaacttgtgatg 600
>gnl|LJGI|TC67978 homologue to UniRef100_P50346 Cluster: 60S acidic ribosomal protein
P0; n=1; Glycine max|Rep: 60S acidic ribosomal protein
P0 - Glycine max (Soybean), partial (97%)
Length = 1416
Score = 58.0 bits (29), Expect = 6e-08
Identities = 53/61 (86%)
Strand = Plus / Plus
Query: 259 ttgattttcaccaaaggtgacttaagggaggtcagcgaacaggttgcaaagtacaaggtt 318
||||| ||||| ||||||||||| | |||||| ||||| ||||||| ||||||||||||
Sbjct: 403 ttgatcttcacaaaaggtgacttgaaggaggttagcgaggaggttgctaagtacaaggtt 462
Query: 319 g 319
|
Sbjct: 463 g 463