Miyakogusa Predicted Gene

Lj4g3v1388810.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1388810.2 Non Chatacterized Hit- tr|I1MUP3|I1MUP3_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,81.61,1e-34,P-loop
containing nucleoside triphosphate hydrolases,NULL; AAA,ATPase,
AAA-type, core; no descriptio,CUFF.49121.2
         (348 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV418768 homologue to UniRef100_A7PHF9 Cluster: Chromos...    56   1e-07

>gnl|LJGI|AV418768 homologue to UniRef100_A7PHF9 Cluster: Chromosome chr17
           scaffold_16, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_16, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (7%)
          Length = 260

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  acaggtaaaacaatgcttgcaaaggcaattgctactgaagctggggcaaactttatcaac 147
           ||||| ||||||||||||||||||||  | || |||||||| || || || || || || 
Sbjct: 114 acaggcaaaacaatgcttgcaaaggctgtagcaactgaagcaggagcgaatttcattaat 173

                                       
Query: 148 atttctctgtctagcattacttctaagt 175
           |||||| |||| ||||||||||| ||||
Sbjct: 174 atttctatgtccagcattacttccaagt 201