Miyakogusa Predicted Gene

Lj4g3v1387920.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1387920.1 tr|G7JLD8|G7JLD8_MEDTR Subtilisin-like serine
protease OS=Medicago truncatula GN=MTR_4g103490 PE=4
S,65.84,0,SUBTILISIN-LIKE PROTEASE (PLANT),NULL; PROPROTEIN CONVERTASE
SUBTILISIN/KEXIN,Peptidase S8, subtilis,CUFF.49097.1
         (1179 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin...    72   9e-12
gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase...    66   5e-10
gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...    64   2e-09
gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...    64   2e-09
gnl|LJGI|AV420480 similar to UniRef100_A7Q1K2 Cluster: Chromosom...    58   1e-07
gnl|LJGI|BP075672 similar to UniRef100_Q84TU2 Cluster: Subtilisi...    52   8e-06

>gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin-like protease; n=2;
           Glycine max|Rep: Subtilisin-like protease - Glycine max
           (Soybean), partial (40%)
          Length = 1250

 Score = 71.9 bits (36), Expect = 9e-12
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 594 ttggagtcctgctgctatcaagtcagcaataatgaccacagcaactac 641
           ||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 563 ttggagtcctgctgctatcaaatcagcaattatgaccacagctactac 610


>gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin; n=1; Medicago
           truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
           sedolisin - Medicago truncatula (Barrel medic), partial
           (26%)
          Length = 729

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                       
Query: 583 cttcatccatattggagtcctgctgctatcaagtcagcaataatgaccacagcaactaca 642
           ||||||||  ||||||||||  ||||||| || |||||||| ||||||||||||| ||||
Sbjct: 445 cttcatcctaattggagtccatctgctattaaatcagcaatcatgaccacagcaagtaca 504

                    
Query: 643 aaagataac 651
           | |||||||
Sbjct: 505 agagataac 513


>gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
           subtilisin, kexin, sedolisin; n=1; Medicago
           truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
           sedolisin - Medicago truncatula (Barrel medic), partial
           (28%)
          Length = 861

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 690 ggcaaccccatttgcttatggtgcagggcatattcaacct 729
           |||||||||||||||||||||| |||||||| ||||||||
Sbjct: 79  ggcaaccccatttgcttatggttcagggcatgttcaacct 118


>gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (59%)
          Length = 1964

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 88/104 (84%), Gaps = 2/104 (1%)
 Strand = Plus / Plus

                                                                        
Query: 532  acttcaatgtcatgtcctcatgttgctggcattgttgga-ttgttaaaatctcttcatcc 590
            ||||| ||||| || ||||||||||||||||| | |||| || |||||| | ||||||||
Sbjct: 1784 acttccatgtcttgccctcatgttgctggcatcgctggacttattaaaa-cacttcatcc 1842

                                                        
Query: 591  atattggagtcctgctgctatcaagtcagcaataatgaccacag 634
              |||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1843 taattggagtccggccgctatcaaatcagcaatcatgacgacag 1886


>gnl|LJGI|AV420480 similar to UniRef100_A7Q1K2 Cluster: Chromosome chr7 scaffold_44,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_44, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (17%)
          Length = 412

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 595 tggagtcctgctgctatcaagtcagcaataatgaccacagc 635
           ||||||||||| |||||||| |||||||||||||| |||||
Sbjct: 267 tggagtcctgccgctatcaaatcagcaataatgacaacagc 307


>gnl|LJGI|BP075672 similar to UniRef100_Q84TU2 Cluster: Subtilisin-like seed-specific
           protein; n=1; Arachis hypogaea|Rep: Subtilisin-like
           seed-specific protein - Arachis hypogaea (Peanut),
           partial (19%)
          Length = 437

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 583 cttcatccatattggagtcctgctgctatcaagtcagcaataatgaccac 632
           ||||||||| | |||||||| || |||||||||||||| || ||||||||
Sbjct: 346 cttcatccagaatggagtccagcagctatcaagtcagccattatgaccac 297