Miyakogusa Predicted Gene
- Lj4g3v1303750.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1303750.2 CUFF.48798.2
(372 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58332 similar to UniRef100_A7QYT3 Cluster: Chromosome... 66 2e-10
>gnl|LJGI|TC58332 similar to UniRef100_A7QYT3 Cluster: Chromosome undetermined
scaffold_254, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_254,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (92%)
Length = 1756
Score = 65.9 bits (33), Expect = 2e-10
Identities = 96/117 (82%)
Strand = Plus / Plus
Query: 164 ttgcatttgttttgaacttagcttttgtactaagtattttgggcttcatgattatgcaca 223
|||| |||||||||||| | ||||||| | | ||| | ||||| || | ||||||||||
Sbjct: 876 ttgcttttgttttgaacctggcttttgcattgagtgtcttgggatttcttattatgcaca 935
Query: 224 tttcatttgtggcagctaatactactaccattgaggcatatgagacaaaaactactc 280
| ||||| ||||| | |||||| || || |||||||||||||||| ||||||||||
Sbjct: 936 tatcattggtggctggtaatacgaccactattgaggcatatgagaagaaaactactc 992