Miyakogusa Predicted Gene

Lj4g3v1218330.2
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1218330.2 tr|B7FJ62|B7FJ62_MEDTR Homeobox-leucine zipper
protein HOX17 OS=Medicago truncatula GN=MTR_5g013010
,78.84,0,seg,NULL; coiled-coil,NULL;
Homeodomain-like,Homeodomain-like; HOMEOBOX_1,Homeobox, conserved
site; ,CUFF.48658.2
         (858 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox...   268   5e-71
gnl|LJGI|BP033083                                                     165   6e-40
gnl|LJGI|BW632242 homologue to UniRef100_Q39862 Cluster: Homeobo...   121   8e-27
gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox...   121   8e-27
gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox...   121   8e-27
gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II...    88   1e-16
gnl|LJGI|TC72309 similar to UniRef100_P46665 Cluster: Homeobox-l...    62   6e-09
gnl|LJGI|TC73454 similar to UniRef100_O23208 Cluster: Homeobox-l...    54   1e-06
gnl|LJGI|TC74320 homologue to UniRef100_A7R6H2 Cluster: Chromoso...    52   6e-06
gnl|LJGI|TC64231 homologue to UniRef100_A7R6H2 Cluster: Chromoso...    52   6e-06

>gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (33%)
          Length = 706

 Score =  268 bits (135), Expect = 5e-71
 Identities = 264/307 (85%)
 Strand = Plus / Plus

                                                                       
Query: 457 caaaagttggcactggcaaaacggttaggccttcgacctagacaagtagaggtctggttc 516
           |||||| ||||||||||||| |  |||||||||||| |  ||||||| ||||| ||||||
Sbjct: 46  caaaagatggcactggcaaagcaattaggccttcgagcacgacaagttgaggtgtggttc 105

                                                                       
Query: 517 cagaacagaagagcaaggactaagctgaagcaaactgaggttgactgcgaggtgttgaaa 576
           ||||||||||||||||||||||||||||||||||| ||||| || || ||| |  |||||
Sbjct: 106 cagaacagaagagcaaggactaagctgaagcaaacggaggtagattgtgagtttctgaaa 165

                                                                       
Query: 577 aggtgctgtgagaatctgacggaggaaaacaggaggttgcagaaggaagttcaggagctg 636
            ||||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| 
Sbjct: 166 cggtgctgcgagaatctgacggaggagaacagaaggttgcagaaggaggttcaggagctc 225

                                                                       
Query: 637 agagcactgaaactttcccctcaattctacatgcaaatgaccccaccaacgaccctcacc 696
           |||||||| || |||||||| || ||||||||||| ||||||||||| || || ||||||
Sbjct: 226 agagcactcaagctttccccgcagttctacatgcagatgaccccaccgaccactctcacc 285

                                                                       
Query: 697 atgtgcccttcttgtgagcgcgtggccgtgccgtcctctgccgttgaggctgcaacgcgc 756
           |||||||| || || ||||||||||| || ||| |||| || |||||  |  | ||||||
Sbjct: 286 atgtgcccatcctgcgagcgcgtggcagttccgccctccgcggttgatccatccacgcgc 345

                  
Query: 757 caccatc 763
           |||||||
Sbjct: 346 caccatc 352


>gnl|LJGI|BP033083 
          Length = 124

 Score =  165 bits (83), Expect = 6e-40
 Identities = 89/91 (97%)
 Strand = Plus / Minus

                                                                       
Query: 768 ggcccaagcccatcatcggcccatgcctgttggcccatgggcttctgcagcgtctatcac 827
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ggcccaagcccatcatcggcccatgcctgttggcccatgggcttctgcagcgtctatcac 65

                                          
Query: 828 tcaccgcccttttgatgttttccgtcactga 858
           ||||||||||||  |||||||||||||||||
Sbjct: 64  tcaccgccctttgaatgttttccgtcactga 34


>gnl|LJGI|BW632242 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (13%)
          Length = 487

 Score =  121 bits (61), Expect = 8e-27
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
           |||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 378 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 437

                                                            
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
           ||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 438 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 486


>gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (30%)
          Length = 635

 Score =  121 bits (61), Expect = 8e-27
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
           |||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 357 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 416

                                                            
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
           ||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 417 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 465



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 413 ttcttgaagagagcttcaaagaacacaataccctcaaccctaa 455
           |||||||||| ||||||||||||||||| || || ||||||||
Sbjct: 591 ttcttgaagaaagcttcaaagaacacaacactcttaaccctaa 633


>gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (29%)
          Length = 716

 Score =  121 bits (61), Expect = 8e-27
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
           |||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 351 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 410

                                                            
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
           ||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 411 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 459


>gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II homeodomain-leucine
           zipper protein; n=1; Medicago sativa|Rep: Type II
           homeodomain-leucine zipper protein - Medicago sativa
           (Alfalfa), partial (26%)
          Length = 487

 Score = 87.7 bits (44), Expect = 1e-16
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                               
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagca 548
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 16  gacaagtagaagtctggttccaaaacagaagagcaaggactaagctgaagca 67


>gnl|LJGI|TC72309 similar to UniRef100_P46665 Cluster: Homeobox-leucine zipper
           protein HAT14; n=1; Arabidopsis thaliana|Rep:
           Homeobox-leucine zipper protein HAT14 - Arabidopsis
           thaliana (Mouse-ear cress), partial (17%)
          Length = 633

 Score = 61.9 bits (31), Expect = 6e-09
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 413 ttcttgaagagagcttcaaagaacacaataccctcaaccctaagcaaaagttggcactgg 472
           ||||||||||||||||||||||||| |  || |||| ||||||||| ||| | | |||||
Sbjct: 545 ttcttgaagagagcttcaaagaacaaaccactctcacccctaagcagaagcttgaactgg 604

                      
Query: 473 caaaacggtta 483
           |||||| ||||
Sbjct: 605 caaaacagtta 615


>gnl|LJGI|TC73454 similar to UniRef100_O23208 Cluster: Homeobox-leucine zipper
           protein ATHB-40; n=1; Arabidopsis thaliana|Rep:
           Homeobox-leucine zipper protein ATHB-40 - Arabidopsis
           thaliana (Mouse-ear cress), partial (46%)
          Length = 873

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 496 agacaagtagaggtctggttccagaacagaagagcaagg 534
           |||||||||| ||| |||||||| |||||||||||||||
Sbjct: 318 agacaagtagcggtttggttccaaaacagaagagcaagg 356


>gnl|LJGI|TC74320 homologue to UniRef100_A7R6H2 Cluster: Chromosome undetermined
           scaffold_1278, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_1278,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (57%)
          Length = 1259

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagcaaactgagg 556
           ||||||| ||||| |||||||||||  | ||||| || || |||||||||||||| ||||
Sbjct: 675 gacaagttgaggtgtggttccagaatcgtagagccagaacaaagctgaagcaaaccgagg 734

                     
Query: 557 ttgactgcga 566
           | || |||||
Sbjct: 735 tggattgcga 744


>gnl|LJGI|TC64231 homologue to UniRef100_A7R6H2 Cluster: Chromosome undetermined
           scaffold_1278, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_1278,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (48%)
          Length = 801

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagcaaactgagg 556
           ||||||| ||||| |||||||||||  | ||||| || || |||||||||||||| ||||
Sbjct: 479 gacaagttgaggtgtggttccagaatcgtagagccagaacaaagctgaagcaaaccgagg 538

                     
Query: 557 ttgactgcga 566
           | || |||||
Sbjct: 539 tggattgcga 548