Miyakogusa Predicted Gene
- Lj4g3v1218330.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1218330.2 tr|B7FJ62|B7FJ62_MEDTR Homeobox-leucine zipper
protein HOX17 OS=Medicago truncatula GN=MTR_5g013010
,78.84,0,seg,NULL; coiled-coil,NULL;
Homeodomain-like,Homeodomain-like; HOMEOBOX_1,Homeobox, conserved
site; ,CUFF.48658.2
(858 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox... 268 5e-71
gnl|LJGI|BP033083 165 6e-40
gnl|LJGI|BW632242 homologue to UniRef100_Q39862 Cluster: Homeobo... 121 8e-27
gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox... 121 8e-27
gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox... 121 8e-27
gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II... 88 1e-16
gnl|LJGI|TC72309 similar to UniRef100_P46665 Cluster: Homeobox-l... 62 6e-09
gnl|LJGI|TC73454 similar to UniRef100_O23208 Cluster: Homeobox-l... 54 1e-06
gnl|LJGI|TC74320 homologue to UniRef100_A7R6H2 Cluster: Chromoso... 52 6e-06
gnl|LJGI|TC64231 homologue to UniRef100_A7R6H2 Cluster: Chromoso... 52 6e-06
>gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
protein - Glycine max (Soybean), partial (33%)
Length = 706
Score = 268 bits (135), Expect = 5e-71
Identities = 264/307 (85%)
Strand = Plus / Plus
Query: 457 caaaagttggcactggcaaaacggttaggccttcgacctagacaagtagaggtctggttc 516
|||||| ||||||||||||| | |||||||||||| | ||||||| ||||| ||||||
Sbjct: 46 caaaagatggcactggcaaagcaattaggccttcgagcacgacaagttgaggtgtggttc 105
Query: 517 cagaacagaagagcaaggactaagctgaagcaaactgaggttgactgcgaggtgttgaaa 576
||||||||||||||||||||||||||||||||||| ||||| || || ||| | |||||
Sbjct: 106 cagaacagaagagcaaggactaagctgaagcaaacggaggtagattgtgagtttctgaaa 165
Query: 577 aggtgctgtgagaatctgacggaggaaaacaggaggttgcagaaggaagttcaggagctg 636
||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 166 cggtgctgcgagaatctgacggaggagaacagaaggttgcagaaggaggttcaggagctc 225
Query: 637 agagcactgaaactttcccctcaattctacatgcaaatgaccccaccaacgaccctcacc 696
|||||||| || |||||||| || ||||||||||| ||||||||||| || || ||||||
Sbjct: 226 agagcactcaagctttccccgcagttctacatgcagatgaccccaccgaccactctcacc 285
Query: 697 atgtgcccttcttgtgagcgcgtggccgtgccgtcctctgccgttgaggctgcaacgcgc 756
|||||||| || || ||||||||||| || ||| |||| || ||||| | | ||||||
Sbjct: 286 atgtgcccatcctgcgagcgcgtggcagttccgccctccgcggttgatccatccacgcgc 345
Query: 757 caccatc 763
|||||||
Sbjct: 346 caccatc 352
>gnl|LJGI|BP033083
Length = 124
Score = 165 bits (83), Expect = 6e-40
Identities = 89/91 (97%)
Strand = Plus / Minus
Query: 768 ggcccaagcccatcatcggcccatgcctgttggcccatgggcttctgcagcgtctatcac 827
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ggcccaagcccatcatcggcccatgcctgttggcccatgggcttctgcagcgtctatcac 65
Query: 828 tcaccgcccttttgatgttttccgtcactga 858
|||||||||||| |||||||||||||||||
Sbjct: 64 tcaccgccctttgaatgttttccgtcactga 34
>gnl|LJGI|BW632242 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
protein - Glycine max (Soybean), partial (13%)
Length = 487
Score = 121 bits (61), Expect = 8e-27
Identities = 97/109 (88%)
Strand = Plus / Plus
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
|||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 378 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 437
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 438 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 486
>gnl|LJGI|TC72963 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
protein - Glycine max (Soybean), partial (30%)
Length = 635
Score = 121 bits (61), Expect = 8e-27
Identities = 97/109 (88%)
Strand = Plus / Plus
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
|||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 357 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 416
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 417 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 465
Score = 54.0 bits (27), Expect = 1e-06
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 413 ttcttgaagagagcttcaaagaacacaataccctcaaccctaa 455
|||||||||| ||||||||||||||||| || || ||||||||
Sbjct: 591 ttcttgaagaaagcttcaaagaacacaacactcttaaccctaa 633
>gnl|LJGI|TC68284 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
protein - Glycine max (Soybean), partial (29%)
Length = 716
Score = 121 bits (61), Expect = 8e-27
Identities = 97/109 (88%)
Strand = Plus / Plus
Query: 212 tcggaatcgacgtgaaccggttaccatccgccgttgattgtgaggaggaagcaggggttt 271
|||||||||| ||||| |||||||| |||| ||| ||||| || ||||||||||||||||
Sbjct: 351 tcggaatcgatgtgaatcggttaccgtccggcgtcgattgcgaagaggaagcaggggttt 410
Query: 272 catctcccaacagcaccgtctccaccgtgagcggaaaacgaagcgagag 320
||||||| |||||||||||||||| ||||||||| || || ||||||||
Sbjct: 411 catctccgaacagcaccgtctccagcgtgagcggcaagcggagcgagag 459
>gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II homeodomain-leucine
zipper protein; n=1; Medicago sativa|Rep: Type II
homeodomain-leucine zipper protein - Medicago sativa
(Alfalfa), partial (26%)
Length = 487
Score = 87.7 bits (44), Expect = 1e-16
Identities = 50/52 (96%)
Strand = Plus / Plus
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagca 548
|||||||||| ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 16 gacaagtagaagtctggttccaaaacagaagagcaaggactaagctgaagca 67
>gnl|LJGI|TC72309 similar to UniRef100_P46665 Cluster: Homeobox-leucine zipper
protein HAT14; n=1; Arabidopsis thaliana|Rep:
Homeobox-leucine zipper protein HAT14 - Arabidopsis
thaliana (Mouse-ear cress), partial (17%)
Length = 633
Score = 61.9 bits (31), Expect = 6e-09
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 413 ttcttgaagagagcttcaaagaacacaataccctcaaccctaagcaaaagttggcactgg 472
||||||||||||||||||||||||| | || |||| ||||||||| ||| | | |||||
Sbjct: 545 ttcttgaagagagcttcaaagaacaaaccactctcacccctaagcagaagcttgaactgg 604
Query: 473 caaaacggtta 483
|||||| ||||
Sbjct: 605 caaaacagtta 615
>gnl|LJGI|TC73454 similar to UniRef100_O23208 Cluster: Homeobox-leucine zipper
protein ATHB-40; n=1; Arabidopsis thaliana|Rep:
Homeobox-leucine zipper protein ATHB-40 - Arabidopsis
thaliana (Mouse-ear cress), partial (46%)
Length = 873
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 496 agacaagtagaggtctggttccagaacagaagagcaagg 534
|||||||||| ||| |||||||| |||||||||||||||
Sbjct: 318 agacaagtagcggtttggttccaaaacagaagagcaagg 356
>gnl|LJGI|TC74320 homologue to UniRef100_A7R6H2 Cluster: Chromosome undetermined
scaffold_1278, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_1278,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (57%)
Length = 1259
Score = 52.0 bits (26), Expect = 6e-06
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagcaaactgagg 556
||||||| ||||| ||||||||||| | ||||| || || |||||||||||||| ||||
Sbjct: 675 gacaagttgaggtgtggttccagaatcgtagagccagaacaaagctgaagcaaaccgagg 734
Query: 557 ttgactgcga 566
| || |||||
Sbjct: 735 tggattgcga 744
>gnl|LJGI|TC64231 homologue to UniRef100_A7R6H2 Cluster: Chromosome undetermined
scaffold_1278, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_1278,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (48%)
Length = 801
Score = 52.0 bits (26), Expect = 6e-06
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 497 gacaagtagaggtctggttccagaacagaagagcaaggactaagctgaagcaaactgagg 556
||||||| ||||| ||||||||||| | ||||| || || |||||||||||||| ||||
Sbjct: 479 gacaagttgaggtgtggttccagaatcgtagagccagaacaaagctgaagcaaaccgagg 538
Query: 557 ttgactgcga 566
| || |||||
Sbjct: 539 tggattgcga 548