Miyakogusa Predicted Gene

Lj4g3v1108190.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1108190.1 tr|F6HGF2|F6HGF2_VITVI DNA-directed RNA
polymerase OS=Vitis vinifera GN=VIT_01s0010g00690 PE=3
SV=1,89.81,0,RNA_pol,DNA-directed RNA polymerase, phage-type; no
description,NULL; DNA/RNA polymerases,NULL;
DNA-,NODE_37037_length_3713_cov_14.511716.path4.1
         (330 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-direc...   428   e-120
gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-direct...   151   3e-36

>gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
           n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
           Vitis vinifera (Grape), partial (13%)
          Length = 520

 Score =  428 bits (216), Expect = e-120
 Identities = 216/216 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgactaaaagacagagaacagcttttgccccaaattttgttcactctcttgatggttct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 atgactaaaagacagagaacagcttttgccccaaattttgttcactctcttgatggttct 257

                                                                       
Query: 61  cacatgatgatgactgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 258 cacatgatgatgactgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcat 317

                                                                       
Query: 121 gattcatattggacacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 gattcatattggacacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaag 377

                                               
Query: 181 tttgttgaactctacgaggctccagtattggaaaat 216
           ||||||||||||||||||||||||||||||||||||
Sbjct: 378 tttgttgaactctacgaggctccagtattggaaaat 413


>gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
           n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
           Vitis vinifera (Grape), partial (22%)
          Length = 1297

 Score =  151 bits (76), Expect = 3e-36
 Identities = 178/212 (83%)
 Strand = Plus / Plus

                                                                       
Query: 13  cagagaacagcttttgccccaaattttgttcactctcttgatggttctcacatgatgatg 72
           ||||| ||||| ||| | ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 385 cagaggacagcatttccgccaaattttgttcactcacttgatggttctcatatgatgatg 444

                                                                       
Query: 73  actgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcatgattcatattgg 132
           ||||||||||| || ||| ||||||| |||   || || ||||| |||||||||||||||
Sbjct: 445 actgcagttgcctgcaaacaagcaggcttggcttttgccggggtccatgattcatattgg 504

                                                                       
Query: 133 acacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaagtttgttgaactc 192
           || || ||||||||||| ||||| ||||| ||  ||||||| |  || ||||| ||||||
Sbjct: 505 acgcatgcgtgtgatgtggatgatatgaacagaatactgagagggaaatttgtagaactc 564

                                           
Query: 193 tacgaggctccagtattggaaaatttgttgga 224
           || ||| | ||| || |||||||||| |||||
Sbjct: 565 tatgagaccccaatactggaaaatttattgga 596