Miyakogusa Predicted Gene
- Lj4g3v1108190.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1108190.1 tr|F6HGF2|F6HGF2_VITVI DNA-directed RNA
polymerase OS=Vitis vinifera GN=VIT_01s0010g00690 PE=3
SV=1,89.81,0,RNA_pol,DNA-directed RNA polymerase, phage-type; no
description,NULL; DNA/RNA polymerases,NULL;
DNA-,NODE_37037_length_3713_cov_14.511716.path4.1
(330 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-direc... 428 e-120
gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-direct... 151 3e-36
>gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
Vitis vinifera (Grape), partial (13%)
Length = 520
Score = 428 bits (216), Expect = e-120
Identities = 216/216 (100%)
Strand = Plus / Plus
Query: 1 atgactaaaagacagagaacagcttttgccccaaattttgttcactctcttgatggttct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 atgactaaaagacagagaacagcttttgccccaaattttgttcactctcttgatggttct 257
Query: 61 cacatgatgatgactgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcat 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 258 cacatgatgatgactgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcat 317
Query: 121 gattcatattggacacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaag 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 gattcatattggacacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaag 377
Query: 181 tttgttgaactctacgaggctccagtattggaaaat 216
||||||||||||||||||||||||||||||||||||
Sbjct: 378 tttgttgaactctacgaggctccagtattggaaaat 413
>gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
Vitis vinifera (Grape), partial (22%)
Length = 1297
Score = 151 bits (76), Expect = 3e-36
Identities = 178/212 (83%)
Strand = Plus / Plus
Query: 13 cagagaacagcttttgccccaaattttgttcactctcttgatggttctcacatgatgatg 72
||||| ||||| ||| | ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 385 cagaggacagcatttccgccaaattttgttcactcacttgatggttctcatatgatgatg 444
Query: 73 actgcagttgcttgtaaaaaagcagggttgaacttcgcaggggttcatgattcatattgg 132
||||||||||| || ||| ||||||| ||| || || ||||| |||||||||||||||
Sbjct: 445 actgcagttgcctgcaaacaagcaggcttggcttttgccggggtccatgattcatattgg 504
Query: 133 acacacgcgtgtgatgttgatgaaatgaatagggtactgagggaaaagtttgttgaactc 192
|| || ||||||||||| ||||| ||||| || ||||||| | || ||||| ||||||
Sbjct: 505 acgcatgcgtgtgatgtggatgatatgaacagaatactgagagggaaatttgtagaactc 564
Query: 193 tacgaggctccagtattggaaaatttgttgga 224
|| ||| | ||| || |||||||||| |||||
Sbjct: 565 tatgagaccccaatactggaaaatttattgga 596