Miyakogusa Predicted Gene

Lj4g3v0804500.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0804500.1 Non Chatacterized Hit- tr|I1K283|I1K283_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,72.92,0.00000002,
,NODE_45623_length_1178_cov_19.471138.path2.1
         (142 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC598805 weakly similar to UniRef100_Q2CHG7 Cluster: Pa...    66   6e-11

>gnl|LJGI|DC598805 weakly similar to UniRef100_Q2CHG7 Cluster: Parallel beta-helix
          repeat protein; n=1; Oceanicola granulosus
          HTCC2516|Rep: Parallel beta-helix repeat protein -
          Oceanicola granulosus HTCC2516, partial (3%)
          Length = 574

 Score = 65.9 bits (33), Expect = 6e-11
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                               
Query: 1  atgggtaactcatccaaggacgattccgccacctccg 37
          |||| ||||||||||||||||||||||||||||||||
Sbjct: 19 atggctaactcatccaaggacgattccgccacctccg 55



 Score = 61.9 bits (31), Expect = 9e-10
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 58  ggcgacgttcagccctccaaaccccccatctacaccgagggcgagaaagtgctcgccca 116
           ||||| |||||||||| |||  |||||| |||| ||||||||||||||||| |||||||
Sbjct: 505 ggcgaggttcagcccttcaatacccccacctactccgagggcgagaaagtgttcgccca 563