Miyakogusa Predicted Gene
- Lj4g3v0783230.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0783230.1 tr|Q84LR0|Q84LR0_SOLLC Metal transporter
OS=Solanum lycopersicum GN=NRAMP3 PE=2 SV=1,73.33,2e-19,Nramp,Natural
resistance-associated macrophage protein; NATURAL
RESISTANCE-ASSOCIATED MACROPHAGE PRO,CUFF.48044.1
(186 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66340 similar to UniRef100_Q7X9B8 Cluster: Ferrous io... 244 2e-64
gnl|LJGI|BI418224 homologue to UniRef100_Q7X9B8 Cluster: Ferrous... 232 6e-61
gnl|LJGI|BI420728 homologue to UniRef100_Q7X9B8 Cluster: Ferrous... 172 5e-43
gnl|LJGI|TC81525 similar to UniRef100_Q9SNV9 Cluster: Metal tran... 50 5e-06
>gnl|LJGI|TC66340 similar to UniRef100_Q7X9B8 Cluster: Ferrous ion membrane transport
protein DMT1; n=1; Glycine max|Rep: Ferrous ion membrane
transport protein DMT1 - Glycine max (Soybean), partial
(66%)
Length = 1129
Score = 244 bits (123), Expect = 2e-64
Identities = 168/183 (91%)
Strand = Plus / Plus
Query: 2 tggcggagctgtgcagggaggagtatcccacgtgggctaggatggtgctgtgggccatgg 61
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||
Sbjct: 380 tggcggagctgtgcagggaggagtaccccacgtgggctaggatggtgctgtgggttatgg 439
Query: 62 cggaggttaatctcattggttctgatattcaagaggttattggcagtgctattgccattc 121
| |||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 440 ctgaggttgctctcattggttctgatattcaagaggttattggtagtgctattgcgataa 499
Query: 122 gggttcttagtaacggggtcatgcccctttgggctggggttgtcattactgctcttgatt 181
|| |||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 500 ggattctcagtaatggggttgtgcccctttgggctggggttgtcattactgctcttgatt 559
Query: 182 ggt 184
|||
Sbjct: 560 ggt 562
>gnl|LJGI|BI418224 homologue to UniRef100_Q7X9B8 Cluster: Ferrous ion membrane
transport protein DMT1; n=1; Glycine max|Rep: Ferrous
ion membrane transport protein DMT1 - Glycine max
(Soybean), partial (30%)
Length = 558
Score = 232 bits (117), Expect = 6e-61
Identities = 165/181 (91%)
Strand = Plus / Plus
Query: 2 tggcggagctgtgcagggaggagtatcccacgtgggctaggatggtgctgtgggccatgg 61
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||
Sbjct: 351 tggcggagctgtgcagggaggagtaccccacgtgggctaggatggtgctgtgggttatgg 410
Query: 62 cggaggttaatctcattggttctgatattcaagaggttattggcagtgctattgccattc 121
| |||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 411 ctgaggttgctctcattggttctgatattcaagaggttattggtagtgctattgcgataa 470
Query: 122 gggttcttagtaacggggtcatgcccctttgggctggggttgtcattactgctcttgatt 181
|| |||| ||||| ||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 471 ggattctcagtaatggggttgtgcccctttgggctgaggttgtcattactgctcttgatt 530
Query: 182 g 182
|
Sbjct: 531 g 531
>gnl|LJGI|BI420728 homologue to UniRef100_Q7X9B8 Cluster: Ferrous ion membrane
transport protein DMT1; n=1; Glycine max|Rep: Ferrous
ion membrane transport protein DMT1 - Glycine max
(Soybean), partial (25%)
Length = 516
Score = 172 bits (87), Expect = 5e-43
Identities = 108/115 (93%)
Strand = Plus / Plus
Query: 2 tggcggagctgtgcagggaggagtatcccacgtgggctaggatggtgctgtgggccatgg 61
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||
Sbjct: 389 tggcggagctgtgcagggaggagtaccccacgtgggctaggatggtgctgtgggttatgg 448
Query: 62 cggaggttaatctcattggttctgatattcaagaggttattggcagtgctattgc 116
| |||||| ||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 449 ctgaggttgctctcattggttctgatattcaagaggttattggtagtgctattgc 503
>gnl|LJGI|TC81525 similar to UniRef100_Q9SNV9 Cluster: Metal transporter Nramp3; n=1;
Arabidopsis thaliana|Rep: Metal transporter Nramp3 -
Arabidopsis thaliana (Mouse-ear cress), partial (23%)
Length = 482
Score = 50.1 bits (25), Expect = 5e-06
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 2 tggcggagctgtgcagggaggagtatcccacgtgggctaggatggtgctgtgg 54
|||||||||| |||||||| |||||||| ||||||||||| |||||||||
Sbjct: 409 tggcggagctttgcagggatgagtatccgttttgggctaggattgtgctgtgg 461