Miyakogusa Predicted Gene

Lj4g3v0758310.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0758310.2 Non Chatacterized Hit- tr|I1K2D2|I1K2D2_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.8363
PE=,78.93,0,NPH3,NPH3; seg,NULL; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAMED,NULL,CUFF.47996.2
         (1554 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80607 similar to UniRef100_A7QL55 Cluster: Chromosome...   214   1e-54
gnl|LJGI|AV776738                                                     172   4e-42
gnl|LJGI|TC76715 similar to UniRef100_A7PLP6 Cluster: Chromosome...    60   4e-08

>gnl|LJGI|TC80607 similar to UniRef100_A7QL55 Cluster: Chromosome chr3 scaffold_117,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr3 scaffold_117, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (21%)
          Length = 506

 Score =  214 bits (108), Expect = 1e-54
 Identities = 207/240 (86%)
 Strand = Plus / Plus

                                                                        
Query: 883  aaactggtggatgcctatcttgctgagattgcgcgcgattccggtttacctatttcaaaa 942
            ||||||||||||| ||| |||||||||||||| || ||| || |||| ||| | || || 
Sbjct: 267  aaactggtggatggctaccttgctgagattgcacgggatcccagtttgcctgtctcgaat 326

                                                                        
Query: 943  tttgtcaatcttgctgaattggtatcaagcttcccaagagaaactcatgatggtctttat 1002
            || ||| ||||||| |||||||||||||||||||| ||| ||||||||||||||||||||
Sbjct: 327  ttcgtcgatcttgccgaattggtatcaagcttccctagacaaactcatgatggtctttat 386

                                                                        
Query: 1003 cgtgccattgatatgtacttaaaggaacatactggaatcagcaagagcgagaagaaaaga 1062
            || |||||||| |||||||||||||||||| |||||||||||||||| |||  |||||||
Sbjct: 387  cgcgccattgacatgtacttaaaggaacatcctggaatcagcaagagtgagcggaaaaga 446

                                                                        
Query: 1063 atatgcaggttgataaactgcagtaaattgtctgcagaagcttgcatgcatgctgtgcag 1122
            || || |  |||||  ||||||| || |||||| |||||||||||||||| || ||||||
Sbjct: 447  atgtgtaaattgatggactgcagaaagttgtctccagaagcttgcatgcacgccgtgcag 506



 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 652 ttggagagatctgagctgatgaggagaattggtcagtgccttgaggaggctaaggtggct 711
           |||| ||||||||| ||||||| ||||||  | |  |||||||||||||||   ||||||
Sbjct: 21  ttggtgagatctgaactgatgacgagaataagccgatgccttgaggaggcttcagtggct 80

                       
Query: 712 gatcttttgatt 723
           ||||||||||||
Sbjct: 81  gatcttttgatt 92


>gnl|LJGI|AV776738 
          Length = 247

 Score =  172 bits (87), Expect = 4e-42
 Identities = 87/87 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1468 gagacatcagagagccctgcttctactgttgtagaggaaacaaaatctacctcatctaga 1527
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247  gagacatcagagagccctgcttctactgttgtagaggaaacaaaatctacctcatctaga 188

                                       
Query: 1528 agcaggagaatttcagtttcatagacc 1554
            |||||||||||||||||||||||||||
Sbjct: 187  agcaggagaatttcagtttcatagacc 161


>gnl|LJGI|TC76715 similar to UniRef100_A7PLP6 Cluster: Chromosome chr7 scaffold_20,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr7 scaffold_20, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (15%)
          Length = 613

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1400 tcatgtcaaagaagatattctccaagatttggtcaagcaaagaaaggaatggtgagttaa 1459
            ||||||| |||||||| ||||| ||  | ||||||||||  ||| | || || ||| || 
Sbjct: 183  tcatgtccaagaagattttctctaaactctggtcaagcagggaacgaaacggagagatat 242

                                                          
Query: 1460 ctagctctgagacatcagagagccctgcttctactgttgtagagga 1505
            |||||||||| ||||| || |||||||||||||| ||||| |||||
Sbjct: 243  ctagctctgatacatcggaaagccctgcttctaccgttgttgagga 288