Miyakogusa Predicted Gene
- Lj4g3v0756940.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0756940.1 Non Chatacterized Hit- tr|I1K2E7|I1K2E7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51881
PE,83.05,0,TELOMERIC REPEAT BINDING PROTEIN 1,NULL; TELOMERIC REPEAT
BINDING PROTEIN,NULL; coiled-coil,NULL; "W,CUFF.47973.1
(891 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transc... 426 e-118
gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transc... 262 3e-69
gnl|LJGI|TC76868 similar to UniRef100_Q0PJK3 Cluster: MYB transc... 141 8e-33
gnl|LJGI|BP070035 UniRef100_Q0PJG6 Cluster: MYB transcription fa... 78 1e-13
gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transc... 64 2e-09
>gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transcription factor
MYB130; n=1; Glycine max|Rep: MYB transcription factor
MYB130 - Glycine max (Soybean), partial (35%)
Length = 579
Score = 426 bits (215), Expect = e-118
Identities = 221/223 (99%)
Strand = Plus / Plus
Query: 669 aaaatcccaaattgatgcagaactatctaaagggaagaggatgacagctcaagaggcagc 728
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 aaaatcccaaattgatgcagaactatctaaagggaagaggatgacagctcaagaggcagc 60
Query: 729 ggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacaggctgaggcagc 788
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacaggctgaggcagc 120
Query: 789 agccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgcaaaagc 848
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 121 agccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgccaaagc 180
Query: 849 agcaatgaaggcattaaaatgcaaaatgcttcatttctgatgg 891
|||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 181 agcaatgaaggcattaaaatgccaaatgcttcatttctgatgg 223
>gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transcription factor
MYB85; n=1; Glycine max|Rep: MYB transcription factor
MYB85 - Glycine max (Soybean), partial (35%)
Length = 757
Score = 262 bits (132), Expect = 3e-69
Identities = 192/212 (90%)
Strand = Plus / Plus
Query: 1 atgggtgctcctaagcagaagtggactgcggaagaagaagcggcgctgaaagccggagta 60
|||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||
Sbjct: 445 atgggtgctcctaagcagaaatggactgcagaagaagaagcggcgctgaaagctggagta 504
Query: 61 gtcaaacatggggcaggaaaatggcgcactatacttacagatcctgagttcagttccatc 120
|||||||| ||||| |||||||||||||| ||||||||||| || |||| |||| | |
Sbjct: 505 gtcaaacacggggctggaaaatggcgcaccatacttacagacccagagtacagtgctgtt 564
Query: 121 ttgcgcatgcgttcaaatgtagatctcaaggataagtggaggaatataaatgtgacagca 180
|||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 565 ttgcgcatgcgttctaatgtagatctcaaggacaaatggaggaacataaatgtgacagca 624
Query: 181 atatggggatcccggcagaaggcaaagcttgc 212
||||||||||| ||||||| |||||||||||
Sbjct: 625 atatggggatctaggcagaaagcaaagcttgc 656
>gnl|LJGI|TC76868 similar to UniRef100_Q0PJK3 Cluster: MYB transcription factor
MYB85; n=1; Glycine max|Rep: MYB transcription factor
MYB85 - Glycine max (Soybean), partial (36%)
Length = 733
Score = 141 bits (71), Expect = 8e-33
Identities = 187/225 (83%), Gaps = 3/225 (1%)
Strand = Plus / Plus
Query: 661 atcctttcaaaatcccaaattgatgcagaactatctaaagggaagag---gatgacagct 717
||||||||||||||||||||||||||||| |||| |||| | | | | || |||||
Sbjct: 116 atcctttcaaaatcccaaattgatgcagagatatcaaaagcaaggggcgtggtggcagct 175
Query: 718 caagaggcagcggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacag 777
||||| ||||| || || || ||||||||||||| ||||||||| ||| |||| ||
Sbjct: 176 caagaagcagcagcggctgcagcaaaagcagttgcagaggcagaagctgcgattgctgag 235
Query: 778 gctgaggcagcagccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtg 837
|||||||||||||| ||||||||||||||||||||||||||||| ||| || | ||||
Sbjct: 236 gctgaggcagcagctagggaggcagaggctgcagaagctgaagcagagcaggcccgagtg 295
Query: 838 tttgcaaaagcagcaatgaaggcattaaaatgcaaaatgcttcat 882
|||||||||||| || ||||||| ||||||||| || |||||||
Sbjct: 296 tttgcaaaagcactaacgaaggcactaaaatgcagaacgcttcat 340
>gnl|LJGI|BP070035 UniRef100_Q0PJG6 Cluster: MYB transcription factor MYB130; n=1;
Glycine max|Rep: MYB transcription factor MYB130 -,
partial (3%)
Length = 260
Score = 77.8 bits (39), Expect = 1e-13
Identities = 39/39 (100%)
Strand = Plus / Minus
Query: 849 agcaatgaaggcattaaaatgcaaaatgcttcatttctg 887
|||||||||||||||||||||||||||||||||||||||
Sbjct: 260 agcaatgaaggcattaaaatgcaaaatgcttcatttctg 222
>gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transcription factor
MYB55; n=1; Glycine max|Rep: MYB transcription factor
MYB55 - Glycine max (Soybean), partial (20%)
Length = 606
Score = 63.9 bits (32), Expect = 2e-09
Identities = 62/72 (86%)
Strand = Plus / Plus
Query: 787 gcagccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgcaaaa 846
|||||| | ||||||||||||||||||||||| || |||||||| ||| |||||| ||
Sbjct: 105 gcagcccgagaggcagaggctgcagaagctgaggcggaggctgcagaagcttttgcacaa 164
Query: 847 gcagcaatgaag 858
|| |||||||||
Sbjct: 165 gctgcaatgaag 176