Miyakogusa Predicted Gene

Lj4g3v0756940.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0756940.1 Non Chatacterized Hit- tr|I1K2E7|I1K2E7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51881
PE,83.05,0,TELOMERIC REPEAT BINDING PROTEIN 1,NULL; TELOMERIC REPEAT
BINDING PROTEIN,NULL; coiled-coil,NULL; "W,CUFF.47973.1
         (891 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transc...   426   e-118
gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transc...   262   3e-69
gnl|LJGI|TC76868 similar to UniRef100_Q0PJK3 Cluster: MYB transc...   141   8e-33
gnl|LJGI|BP070035 UniRef100_Q0PJG6 Cluster: MYB transcription fa...    78   1e-13
gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transc...    64   2e-09

>gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transcription factor
           MYB130; n=1; Glycine max|Rep: MYB transcription factor
           MYB130 - Glycine max (Soybean), partial (35%)
          Length = 579

 Score =  426 bits (215), Expect = e-118
 Identities = 221/223 (99%)
 Strand = Plus / Plus

                                                                       
Query: 669 aaaatcccaaattgatgcagaactatctaaagggaagaggatgacagctcaagaggcagc 728
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   aaaatcccaaattgatgcagaactatctaaagggaagaggatgacagctcaagaggcagc 60

                                                                       
Query: 729 ggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacaggctgaggcagc 788
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacaggctgaggcagc 120

                                                                       
Query: 789 agccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgcaaaagc 848
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 121 agccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgccaaagc 180

                                                      
Query: 849 agcaatgaaggcattaaaatgcaaaatgcttcatttctgatgg 891
           |||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 181 agcaatgaaggcattaaaatgccaaatgcttcatttctgatgg 223


>gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transcription factor
           MYB85; n=1; Glycine max|Rep: MYB transcription factor
           MYB85 - Glycine max (Soybean), partial (35%)
          Length = 757

 Score =  262 bits (132), Expect = 3e-69
 Identities = 192/212 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtgctcctaagcagaagtggactgcggaagaagaagcggcgctgaaagccggagta 60
           |||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||
Sbjct: 445 atgggtgctcctaagcagaaatggactgcagaagaagaagcggcgctgaaagctggagta 504

                                                                       
Query: 61  gtcaaacatggggcaggaaaatggcgcactatacttacagatcctgagttcagttccatc 120
           |||||||| ||||| |||||||||||||| ||||||||||| || |||| |||| |  | 
Sbjct: 505 gtcaaacacggggctggaaaatggcgcaccatacttacagacccagagtacagtgctgtt 564

                                                                       
Query: 121 ttgcgcatgcgttcaaatgtagatctcaaggataagtggaggaatataaatgtgacagca 180
           |||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 565 ttgcgcatgcgttctaatgtagatctcaaggacaaatggaggaacataaatgtgacagca 624

                                           
Query: 181 atatggggatcccggcagaaggcaaagcttgc 212
           |||||||||||  ||||||| |||||||||||
Sbjct: 625 atatggggatctaggcagaaagcaaagcttgc 656


>gnl|LJGI|TC76868 similar to UniRef100_Q0PJK3 Cluster: MYB transcription factor
           MYB85; n=1; Glycine max|Rep: MYB transcription factor
           MYB85 - Glycine max (Soybean), partial (36%)
          Length = 733

 Score =  141 bits (71), Expect = 8e-33
 Identities = 187/225 (83%), Gaps = 3/225 (1%)
 Strand = Plus / Plus

                                                                       
Query: 661 atcctttcaaaatcccaaattgatgcagaactatctaaagggaagag---gatgacagct 717
           |||||||||||||||||||||||||||||  |||| ||||  | | |   | || |||||
Sbjct: 116 atcctttcaaaatcccaaattgatgcagagatatcaaaagcaaggggcgtggtggcagct 175

                                                                       
Query: 718 caagaggcagcggctgcagctgcaaaagcagttgttgaggcagaacttgccgttgcacag 777
           ||||| ||||| || || || |||||||||||||  |||||||||  |||  ||||  ||
Sbjct: 176 caagaagcagcagcggctgcagcaaaagcagttgcagaggcagaagctgcgattgctgag 235

                                                                       
Query: 778 gctgaggcagcagccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtg 837
           |||||||||||||| ||||||||||||||||||||||||||||| |||   || | ||||
Sbjct: 236 gctgaggcagcagctagggaggcagaggctgcagaagctgaagcagagcaggcccgagtg 295

                                                        
Query: 838 tttgcaaaagcagcaatgaaggcattaaaatgcaaaatgcttcat 882
           ||||||||||||  || ||||||| ||||||||| || |||||||
Sbjct: 296 tttgcaaaagcactaacgaaggcactaaaatgcagaacgcttcat 340


>gnl|LJGI|BP070035 UniRef100_Q0PJG6 Cluster: MYB transcription factor MYB130; n=1;
           Glycine max|Rep: MYB transcription factor MYB130 -,
           partial (3%)
          Length = 260

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                  
Query: 849 agcaatgaaggcattaaaatgcaaaatgcttcatttctg 887
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 260 agcaatgaaggcattaaaatgcaaaatgcttcatttctg 222


>gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transcription factor
           MYB55; n=1; Glycine max|Rep: MYB transcription factor
           MYB55 - Glycine max (Soybean), partial (20%)
          Length = 606

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 787 gcagccagggaggcagaggctgcagaagctgaagctgaggctgctcaagtgtttgcaaaa 846
           |||||| | ||||||||||||||||||||||| || ||||||||  |||  |||||| ||
Sbjct: 105 gcagcccgagaggcagaggctgcagaagctgaggcggaggctgcagaagcttttgcacaa 164

                       
Query: 847 gcagcaatgaag 858
           || |||||||||
Sbjct: 165 gctgcaatgaag 176