Miyakogusa Predicted Gene

Lj4g3v0685340.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0685340.1 Non Chatacterized Hit- tr|I1JUZ3|I1JUZ3_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=4,54.43,1e-18,
,CUFF.47931.1
         (399 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO039427 homologue to UniRef100_A3SNI4 Cluster: UDP-N-a...    66   2e-10

>gnl|LJGI|GO039427 homologue to UniRef100_A3SNI4 Cluster: UDP-N-acetylglucosamine
           pyrophosphorylase; n=1; Roseovarius nubinhibens ISM|Rep:
           UDP-N-acetylglucosamine pyrophosphorylase - Roseovarius
           nubinhibens ISM, partial (5%)
          Length = 864

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 39  tggctttgtttgcatttctcttttctttctgatattttcaagctggatccagcaagggtt 98
           |||||||||||||| ||||||||| ||| ||| | |||||||||||||||| || |||||
Sbjct: 431 tggctttgtttgcacttctcttttgtttatgacaatttcaagctggatccaccaggggtt 490

            
Query: 99  a 99
           |
Sbjct: 491 a 491