Miyakogusa Predicted Gene
- Lj4g3v0669830.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0669830.1 Non Chatacterized Hit- tr|I3S2S9|I3S2S9_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,99.22,0,14-3-3
protein,14-3-3 domain; coiled-coil,NULL; 14-3-3,14-3-3 domain; 14-3-3
homologues,14-3-3 domai,CUFF.47894.1
(777 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 p... 1540 0.0
gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 pro... 841 0.0
gnl|LJGI|GO037405 similar to UniRef100_Q6CQE3 Cluster: Kluyverom... 151 8e-36
gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 p... 121 7e-27
gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-l... 82 6e-15
gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 p... 74 1e-12
gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 72 6e-12
gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 72 6e-12
gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA dama... 66 3e-10
gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 64 1e-09
gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-... 60 2e-08
gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik... 60 2e-08
gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3... 60 2e-08
gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 p... 60 2e-08
gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik... 60 2e-08
gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-l... 56 3e-07
gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 p... 56 3e-07
gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-lik... 54 1e-06
>gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (94%)
Length = 1181
Score = 1540 bits (777), Expect = 0.0
Identities = 777/777 (100%)
Strand = Plus / Plus
Query: 1 atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82 atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 141
Query: 61 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 201
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 261
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 321
Query: 241 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 381
Query: 301 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 441
Query: 361 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 442 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 501
Query: 421 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 561
Query: 481 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 621
Query: 541 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 681
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 741
Query: 661 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 801
Query: 721 gatggaggtgatgaaatcaaaacagaagaaacaaaacctgctgaacaggagcactaa 777
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gatggaggtgatgaaatcaaaacagaagaaacaaaacctgctgaacaggagcactaa 858
>gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (98%)
Length = 1252
Score = 841 bits (424), Expect = 0.0
Identities = 652/728 (89%)
Strand = Plus / Plus
Query: 1 atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 60
||||| |||||||| ||||||||||| ||||||||| ||||||||||| |||| |||||
Sbjct: 82 atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 141
Query: 61 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 120
|| ||||||||||||||||| || || |||||| ||| ||||||||||||||||||||
Sbjct: 142 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 201
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 261
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 240
||||| |||||||||||||| || || || |||||||||||| | |||||||||||| |
Sbjct: 262 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 321
Query: 241 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 300
||||| || | ||||||| |||| |||| || || ||||||||||| || || |||||
Sbjct: 322 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 381
Query: 301 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 360
|||||| ||||| ||||| ||||||||||| |||||||||||||| |||| ||||||
Sbjct: 382 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 441
Query: 361 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 420
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 442 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 501
Query: 421 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 480
|||||||| ||||| |||||||| ||||||||||| |||| |||||||||||||||||||
Sbjct: 502 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 561
Query: 481 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 540
||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 562 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 621
Query: 541 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 600
|| ||||| ||||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 622 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 681
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
||||| |||||||| ||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 682 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 741
Query: 661 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 720
|||||||||||||||||||||||||||||||| ||||||||||| || ||||| || ||
Sbjct: 742 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 801
Query: 721 gatggagg 728
||||||||
Sbjct: 802 gatggagg 809
>gnl|LJGI|GO037405 similar to UniRef100_Q6CQE3 Cluster: Kluyveromyces lactis strain
NRRL Y-1140 chromosome D of strain NRRL Y- 1140 of
Kluyveromyces lactis; n=2; Kluyveromyces lactis|Rep:
Kluyveromyces lactis strain NRRL Y-1140 chromosome D of
strain NRRL Y- 1140 of Kluyveromyces lactis -
Kluyveromyces lactis (Yeast) (Candida sphaerica),
partial (31%)
Length = 286
Score = 151 bits (76), Expect = 8e-36
Identities = 76/76 (100%)
Strand = Plus / Plus
Query: 702 gacctctgatttacctgaggatggaggtgatgaaatcaaaacagaagaaacaaaacctgc 761
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 gacctctgatttacctgaggatggaggtgatgaaatcaaaacagaagaaacaaaacctgc 170
Query: 762 tgaacaggagcactaa 777
||||||||||||||||
Sbjct: 171 tgaacaggagcactaa 186
>gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
amurensis, complete
Length = 1280
Score = 121 bits (61), Expect = 7e-27
Identities = 271/341 (79%)
Strand = Plus / Plus
Query: 370 tactataagatgaaaggtgattattatcgttatcttgctgagttcaagaccgaccaagag 429
||||||||||||||||| || ||||||||||||||||| || || ||| | | | | |||
Sbjct: 456 tactataagatgaaaggagactattatcgttatcttgcagaatttaagtcaggcaatgag 515
Query: 430 aggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagccactgcaaac 489
| ||||||||| ||||| |||||| | || ||||||||| ||||| | | | ||| |
Sbjct: 516 aagaaggaggctgctgatcagtcaatgaaagcatatgagtctgctaccactgcagcagag 575
Query: 490 acagatcttccttcaacacatccaatccgtcttggacttgcactcaacttctcagtcttc 549
| || | || | || ||||| |||||||| || || || || || |||||||| |||
Sbjct: 576 gctgaattaccccccactcatcccatccgtctgggcctggctctaaatttctcagttttc 635
Query: 550 tattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaagctttcgat 609
||||||||||| |||| ||||||||||| ||||||||| | || || |||||||| |||
Sbjct: 636 tattatgagatcctgaattcacctgaaagagcctgtcatcttgcaaagcaagcttttgat 695
Query: 610 gaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttgatc 669
|| || ||| | ||| | || ||||||| ||||||||||||||| || ||||| ||||||
Sbjct: 696 gaagctatttcagagcttgataccttgaatgaagagtcatacaaagatagcaccttgatc 755
Query: 670 atgcagttgttgagagacaaccttactctctggacctctga 710
||||| | | || |||||||||||||| ||||| |||||
Sbjct: 756 atgcaacttctcagggacaaccttactctatggacttctga 796
Score = 71.9 bits (36), Expect = 6e-12
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
||||| ||||||||||| | || || ||||| ||||| |||||||||||||| | |||
Sbjct: 207 actgttgaagagaggaatttgctttctgtgggttataagaatgtgattggtgctcgcaga 266
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatga 236
|| |||||| | ||| ||||||| ||||| |||||||||||| | || ||||||||
Sbjct: 267 gcgtcgtggaggattctgtcttccattgagcagaaggaagagactaaaggaaatga 322
>gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
Glycine max|Rep: 14-3-3-like protein A - Glycine max
(Soybean), complete
Length = 1153
Score = 81.8 bits (41), Expect = 6e-15
Identities = 62/69 (89%)
Strand = Plus / Plus
Query: 607 gatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttg 666
|||||||||||| ||||| | ||||| ||| |||||||||||||||||||||| || |||
Sbjct: 683 gatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacagtacattg 742
Query: 667 atcatgcag 675
|||||||||
Sbjct: 743 atcatgcag 751
>gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 protein; n=1; Populus
tremula x Populus alba|Rep: 14-3-3 protein - Populus
tremula x Populus alba, partial (56%)
Length = 633
Score = 73.8 bits (37), Expect = 1e-12
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 607 gatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttg 666
|||||||||||| ||||| | ||||| ||| |||||||||||||||||||| | || |||
Sbjct: 267 gatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacggtacattg 326
Query: 667 atcatgcag 675
|||||||||
Sbjct: 327 atcatgcag 335
>gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1048
Score = 71.9 bits (36), Expect = 6e-12
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
||||| ||||| |||||||| |||||||| || || || ||| | || ||||||||||||
Sbjct: 773 aaacaggcttttgatgaggccattgctgaattggatacattgggagaggagtcatacaag 832
Query: 655 gacagcactttgatcatgca 674
|| |||||||||||||||||
Sbjct: 833 gatagcactttgatcatgca 852
>gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (61%)
Length = 741
Score = 71.9 bits (36), Expect = 6e-12
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
||||| ||||| |||||||| |||||||| || || || ||| | || ||||||||||||
Sbjct: 302 aaacaggcttttgatgaggccattgctgaattggatacattgggagaggagtcatacaag 361
Query: 655 gacagcactttgatcatgca 674
|| |||||||||||||||||
Sbjct: 362 gatagcactttgatcatgca 381
>gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA damage checkpoint
protein rad24; n=1; Magnaporthe grisea|Rep: DNA damage
checkpoint protein rad24 - Magnaporthe grisea (Rice
blast fungus) (Pyricularia grisea), partial (88%)
Length = 1127
Score = 65.9 bits (33), Expect = 3e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 40 gccaagctttctgagcaggctgaaagatatgaagaaatggt 80
||||||||| ||||||||||||||||||||||||| |||||
Sbjct: 167 gccaagcttgctgagcaggctgaaagatatgaagagatggt 207
>gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1300
Score = 63.9 bits (32), Expect = 1e-09
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
||||| ||||| || || ||||||||||| || || |||||| | || || |||||||||
Sbjct: 738 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 797
Query: 655 gacagcactttgatcatgca 674
|| |||||||||||||||||
Sbjct: 798 gatagcactttgatcatgca 817
>gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (80%)
Length = 748
Score = 60.0 bits (30), Expect = 2e-08
Identities = 99/122 (81%)
Strand = Plus / Plus
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
|||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 580 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 639
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
|||| |||||||| | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 640 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 699
Query: 710 at 711
||
Sbjct: 700 at 701
>gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
(Garden pea), partial (94%)
Length = 1142
Score = 60.0 bits (30), Expect = 2e-08
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
||||||||||| ||||| |||| || || |||||| | || || ||||||||||| |||
Sbjct: 764 gctttcgatgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagc 823
Query: 661 actttgatcatgca 674
||||||||||||||
Sbjct: 824 actttgatcatgca 837
>gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (94%)
Length = 1199
Score = 60.0 bits (30), Expect = 2e-08
Identities = 99/122 (81%)
Strand = Plus / Plus
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
|||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 827 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 886
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
|||| |||||||| | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 887 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 946
Query: 710 at 711
||
Sbjct: 947 at 948
>gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (42%)
Length = 583
Score = 60.0 bits (30), Expect = 2e-08
Identities = 99/122 (81%)
Strand = Plus / Plus
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
|||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 168 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 227
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
|||| |||||||| | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 228 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 287
Query: 710 at 711
||
Sbjct: 288 at 289
>gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
(Garden pea), partial (96%)
Length = 1248
Score = 60.0 bits (30), Expect = 2e-08
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
||||||||||| ||||| |||| || || |||||| | || || ||||||||||| |||
Sbjct: 743 gctttcgatgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagc 802
Query: 661 actttgatcatgca 674
||||||||||||||
Sbjct: 803 actttgatcatgca 816
>gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
Glycine max|Rep: 14-3-3-like protein A - Glycine max
(Soybean), partial (78%)
Length = 859
Score = 56.0 bits (28), Expect = 3e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 628 gacaccttgagtgaagagtcatacaaggacagcactttgatcatgcag 675
||||| ||| |||||| ||||||||||||||| || ||||||||||||
Sbjct: 606 gacacattgggtgaagggtcatacaaggacagtacattgatcatgcag 653
>gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
amurensis, partial (43%)
Length = 489
Score = 56.0 bits (28), Expect = 3e-07
Identities = 94/116 (81%)
Strand = Plus / Plus
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
||||| ||||||||||| | || || ||||| ||||| |||||||||||||| | | |
Sbjct: 274 actgttgaagagaggaatttgctttctgtgggttataagaatgtgattggtgctcgcaca 333
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatga 236
|| || ||| | ||| ||||||| ||||| |||||||||||| | || ||||||||
Sbjct: 334 gcgtcctggaggattctgtcttccattgagcagaaggaagagactaaaggaaatga 389
>gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-like protein; n=1;
Glycine max|Rep: 14-3-3-like protein - Glycine max
(Soybean), partial (32%)
Length = 567
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 550 tattatgagataatgaactcacctgaaagggcctg 584
||||||||||||||||| ||||||| |||||||||
Sbjct: 68 tattatgagataatgaattcacctgcaagggcctg 102