Miyakogusa Predicted Gene

Lj4g3v0669830.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0669830.1 Non Chatacterized Hit- tr|I3S2S9|I3S2S9_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,99.22,0,14-3-3
protein,14-3-3 domain; coiled-coil,NULL; 14-3-3,14-3-3 domain; 14-3-3
homologues,14-3-3 domai,CUFF.47894.1
         (777 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 p...  1540   0.0  
gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 pro...   841   0.0  
gnl|LJGI|GO037405 similar to UniRef100_Q6CQE3 Cluster: Kluyverom...   151   8e-36
gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 p...   121   7e-27
gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-l...    82   6e-15
gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 p...    74   1e-12
gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    72   6e-12
gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    72   6e-12
gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA dama...    66   3e-10
gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    64   1e-09
gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-...    60   2e-08
gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik...    60   2e-08
gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3...    60   2e-08
gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 p...    60   2e-08
gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik...    60   2e-08
gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-l...    56   3e-07
gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 p...    56   3e-07
gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-lik...    54   1e-06

>gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
           n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
           Lilium longiflorum (Trumpet lily), partial (94%)
          Length = 1181

 Score = 1540 bits (777), Expect = 0.0
 Identities = 777/777 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 141

                                                                       
Query: 61  gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 201

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 261

                                                                       
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 321

                                                                       
Query: 241 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 381

                                                                       
Query: 301 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 441

                                                                       
Query: 361 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 442 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 501

                                                                       
Query: 421 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 561

                                                                       
Query: 481 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 621

                                                                       
Query: 541 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 681

                                                                       
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 741

                                                                       
Query: 661 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 720
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 801

                                                                    
Query: 721 gatggaggtgatgaaatcaaaacagaagaaacaaaacctgctgaacaggagcactaa 777
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gatggaggtgatgaaatcaaaacagaagaaacaaaacctgctgaacaggagcactaa 858


>gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
           n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
           Lilium longiflorum (Trumpet lily), partial (98%)
          Length = 1252

 Score =  841 bits (424), Expect = 0.0
 Identities = 652/728 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 60
           ||||| |||||||| ||||||||||| ||||||||| ||||||||||| |||| ||||| 
Sbjct: 82  atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 141

                                                                       
Query: 61  gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 120
           || ||||||||||||||||| || || ||||||  ||| |||||||||||||||||||| 
Sbjct: 142 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 201

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 261

                                                                       
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 240
           ||||| |||||||||||||| || || || |||||||||||| | ||||||||||||  |
Sbjct: 262 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 321

                                                                       
Query: 241 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 300
           ||||| || | |||||||  |||| |||| || || ||||||||||| || || ||||| 
Sbjct: 322 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 381

                                                                       
Query: 301 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 360
             |||||| ||||| ||||| ||||||||||| |||||||||||||| |||| |||||| 
Sbjct: 382 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 441

                                                                       
Query: 361 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 420
           |  ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 442 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 501

                                                                       
Query: 421 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 480
           |||||||| ||||| |||||||| ||||||||||| |||| |||||||||||||||||||
Sbjct: 502 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 561

                                                                       
Query: 481 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 540
           ||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 562 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 621

                                                                       
Query: 541 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 600
           || ||||| ||||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 622 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 681

                                                                       
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
           ||||| |||||||| ||||| ||||| |||||||||||||||||||||||||||||||| 
Sbjct: 682 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 741

                                                                       
Query: 661 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 720
           |||||||||||||||||||||||||||||||| ||||||||||| || ||||| || || 
Sbjct: 742 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 801

                   
Query: 721 gatggagg 728
           ||||||||
Sbjct: 802 gatggagg 809


>gnl|LJGI|GO037405 similar to UniRef100_Q6CQE3 Cluster: Kluyveromyces lactis strain
           NRRL Y-1140 chromosome D of strain NRRL Y- 1140 of
           Kluyveromyces lactis; n=2; Kluyveromyces lactis|Rep:
           Kluyveromyces lactis strain NRRL Y-1140 chromosome D of
           strain NRRL Y- 1140 of Kluyveromyces lactis -
           Kluyveromyces lactis (Yeast) (Candida sphaerica),
           partial (31%)
          Length = 286

 Score =  151 bits (76), Expect = 8e-36
 Identities = 76/76 (100%)
 Strand = Plus / Plus

                                                                       
Query: 702 gacctctgatttacctgaggatggaggtgatgaaatcaaaacagaagaaacaaaacctgc 761
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 gacctctgatttacctgaggatggaggtgatgaaatcaaaacagaagaaacaaaacctgc 170

                           
Query: 762 tgaacaggagcactaa 777
           ||||||||||||||||
Sbjct: 171 tgaacaggagcactaa 186


>gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
           Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
           amurensis, complete
          Length = 1280

 Score =  121 bits (61), Expect = 7e-27
 Identities = 271/341 (79%)
 Strand = Plus / Plus

                                                                       
Query: 370 tactataagatgaaaggtgattattatcgttatcttgctgagttcaagaccgaccaagag 429
           ||||||||||||||||| || ||||||||||||||||| || || ||| | | | | |||
Sbjct: 456 tactataagatgaaaggagactattatcgttatcttgcagaatttaagtcaggcaatgag 515

                                                                       
Query: 430 aggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagccactgcaaac 489
           | ||||||||| ||||| |||||| | || ||||||||| ||||| |  |  | ||| | 
Sbjct: 516 aagaaggaggctgctgatcagtcaatgaaagcatatgagtctgctaccactgcagcagag 575

                                                                       
Query: 490 acagatcttccttcaacacatccaatccgtcttggacttgcactcaacttctcagtcttc 549
            | ||  | ||  | || ||||| |||||||| || || || || || |||||||| |||
Sbjct: 576 gctgaattaccccccactcatcccatccgtctgggcctggctctaaatttctcagttttc 635

                                                                       
Query: 550 tattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaagctttcgat 609
           |||||||||||  |||| ||||||||||| ||||||||| | || || |||||||| |||
Sbjct: 636 tattatgagatcctgaattcacctgaaagagcctgtcatcttgcaaagcaagcttttgat 695

                                                                       
Query: 610 gaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttgatc 669
           || || ||| | ||| | || ||||||| ||||||||||||||| || ||||| ||||||
Sbjct: 696 gaagctatttcagagcttgataccttgaatgaagagtcatacaaagatagcaccttgatc 755

                                                    
Query: 670 atgcagttgttgagagacaaccttactctctggacctctga 710
           |||||  |  | || |||||||||||||| ||||| |||||
Sbjct: 756 atgcaacttctcagggacaaccttactctatggacttctga 796



 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
           ||||| |||||||||||  | || || ||||| ||||| ||||||||||||||  | |||
Sbjct: 207 actgttgaagagaggaatttgctttctgtgggttataagaatgtgattggtgctcgcaga 266

                                                                   
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatga 236
           || |||||| | ||| ||||||| ||||| |||||||||||| | || ||||||||
Sbjct: 267 gcgtcgtggaggattctgtcttccattgagcagaaggaagagactaaaggaaatga 322


>gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
           Glycine max|Rep: 14-3-3-like protein A - Glycine max
           (Soybean), complete
          Length = 1153

 Score = 81.8 bits (41), Expect = 6e-15
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                       
Query: 607 gatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttg 666
           |||||||||||| ||||| | ||||| ||| |||||||||||||||||||||| || |||
Sbjct: 683 gatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacagtacattg 742

                    
Query: 667 atcatgcag 675
           |||||||||
Sbjct: 743 atcatgcag 751


>gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 protein; n=1; Populus
           tremula x Populus alba|Rep: 14-3-3 protein - Populus
           tremula x Populus alba, partial (56%)
          Length = 633

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 607 gatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagcactttg 666
           |||||||||||| ||||| | ||||| ||| |||||||||||||||||||| | || |||
Sbjct: 267 gatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacggtacattg 326

                    
Query: 667 atcatgcag 675
           |||||||||
Sbjct: 327 atcatgcag 335


>gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), complete
          Length = 1048

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
           ||||| ||||| |||||||| |||||||| || || || ||| | || ||||||||||||
Sbjct: 773 aaacaggcttttgatgaggccattgctgaattggatacattgggagaggagtcatacaag 832

                               
Query: 655 gacagcactttgatcatgca 674
           || |||||||||||||||||
Sbjct: 833 gatagcactttgatcatgca 852


>gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), partial (61%)
          Length = 741

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
           ||||| ||||| |||||||| |||||||| || || || ||| | || ||||||||||||
Sbjct: 302 aaacaggcttttgatgaggccattgctgaattggatacattgggagaggagtcatacaag 361

                               
Query: 655 gacagcactttgatcatgca 674
           || |||||||||||||||||
Sbjct: 362 gatagcactttgatcatgca 381


>gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA damage checkpoint
           protein rad24; n=1; Magnaporthe grisea|Rep: DNA damage
           checkpoint protein rad24 - Magnaporthe grisea (Rice
           blast fungus) (Pyricularia grisea), partial (88%)
          Length = 1127

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 40  gccaagctttctgagcaggctgaaagatatgaagaaatggt 80
           ||||||||| ||||||||||||||||||||||||| |||||
Sbjct: 167 gccaagcttgctgagcaggctgaaagatatgaagagatggt 207


>gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), complete
          Length = 1300

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 595 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 654
           ||||| ||||| || || ||||||||||| || || |||||| | || || |||||||||
Sbjct: 738 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 797

                               
Query: 655 gacagcactttgatcatgca 674
           || |||||||||||||||||
Sbjct: 798 gatagcactttgatcatgca 817


>gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
           Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
           bean), partial (80%)
          Length = 748

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
           |||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 580 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 639

                                                                       
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
           |||| ||||||||  | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 640 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 699

             
Query: 710 at 711
           ||
Sbjct: 700 at 701


>gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
           Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
           (Garden pea), partial (94%)
          Length = 1142

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
           ||||||||||| |||||  |||| || || |||||| | || || ||||||||||| |||
Sbjct: 764 gctttcgatgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagc 823

                         
Query: 661 actttgatcatgca 674
           ||||||||||||||
Sbjct: 824 actttgatcatgca 837


>gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
           Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
           bean), partial (94%)
          Length = 1199

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
           |||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 827 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 886

                                                                       
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
           |||| ||||||||  | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 887 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 946

             
Query: 710 at 711
           ||
Sbjct: 947 at 948


>gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), partial (42%)
          Length = 583

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcat 649
           |||||||||| || || || || || ||||||||| | ||||||||| | ||||| || |
Sbjct: 168 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 227

                                                                       
Query: 650 acaaggacagcactttgatcatgcagttgttgagagacaaccttactctctggacctctg 709
           |||| ||||||||  | ||||||||| | || ||||||||||| || || ||||| ||||
Sbjct: 228 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggacttctg 287

             
Query: 710 at 711
           ||
Sbjct: 288 at 289


>gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
           Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
           (Garden pea), partial (96%)
          Length = 1248

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 601 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 660
           ||||||||||| |||||  |||| || || |||||| | || || ||||||||||| |||
Sbjct: 743 gctttcgatgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagc 802

                         
Query: 661 actttgatcatgca 674
           ||||||||||||||
Sbjct: 803 actttgatcatgca 816


>gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
           Glycine max|Rep: 14-3-3-like protein A - Glycine max
           (Soybean), partial (78%)
          Length = 859

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 628 gacaccttgagtgaagagtcatacaaggacagcactttgatcatgcag 675
           ||||| ||| |||||| ||||||||||||||| || ||||||||||||
Sbjct: 606 gacacattgggtgaagggtcatacaaggacagtacattgatcatgcag 653


>gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
           Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
           amurensis, partial (43%)
          Length = 489

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 180
           ||||| |||||||||||  | || || ||||| ||||| ||||||||||||||  | | |
Sbjct: 274 actgttgaagagaggaatttgctttctgtgggttataagaatgtgattggtgctcgcaca 333

                                                                   
Query: 181 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatga 236
           || || ||| | ||| ||||||| ||||| |||||||||||| | || ||||||||
Sbjct: 334 gcgtcctggaggattctgtcttccattgagcagaaggaagagactaaaggaaatga 389


>gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-like protein; n=1;
           Glycine max|Rep: 14-3-3-like protein - Glycine max
           (Soybean), partial (32%)
          Length = 567

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 550 tattatgagataatgaactcacctgaaagggcctg 584
           ||||||||||||||||| ||||||| |||||||||
Sbjct: 68  tattatgagataatgaattcacctgcaagggcctg 102