Miyakogusa Predicted Gene

Lj4g3v0654390.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0654390.1 tr|Q8DMF5|Q8DMF5_THEEB Tsl0163 protein
OS=Thermosynechococcus elongatus (strain BP-1) GN=tsl0163
PE=,67.14,1e-18,UNCHARACTERIZED,Sulfiredoxin;
ParB/Sulfiredoxin,ParB-like nuclease; ParB-like nuclease
domain,ParB-l,NODE_70688_length_622_cov_56.485531.path1.1
         (225 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036538 similar to UniRef100_Q2MGR0 Cluster: ParB-like...   446   e-125
gnl|LJGI|TC66656 similar to UniRef100_Q2MGR0 Cluster: ParB-like ...   446   e-125

>gnl|LJGI|GO036538 similar to UniRef100_Q2MGR0 Cluster: ParB-like nuclease; n=1;
           Medicago truncatula|Rep: ParB-like nuclease - Medicago
           truncatula (Barrel medic), partial (90%)
          Length = 561

 Score =  446 bits (225), Expect = e-125
 Identities = 225/225 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggacaagagcaaatgatcagaaaaaagttgaggaattaatggatagtattgctgaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 144 atgaggacaagagcaaatgatcagaaaaaagttgaggaattaatggatagtattgctgaa 203

                                                                       
Query: 61  attggtctgcaagtgcctattgacgtccttgaggtcgatggggtctactatggtttctct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 attggtctgcaagtgcctattgacgtccttgaggtcgatggggtctactatggtttctct 263

                                                                       
Query: 121 ggctgtcaccgctacgaggctcaccagcgccttggactccccaccatccgttgcaaaatt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 ggctgtcaccgctacgaggctcaccagcgccttggactccccaccatccgttgcaaaatt 323

                                                        
Query: 181 cgccgtggtacaaaagagactctaaggcatcatttgcgctgaaaa 225
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 cgccgtggtacaaaagagactctaaggcatcatttgcgctgaaaa 368


>gnl|LJGI|TC66656 similar to UniRef100_Q2MGR0 Cluster: ParB-like nuclease; n=1;
           Medicago truncatula|Rep: ParB-like nuclease - Medicago
           truncatula (Barrel medic), complete
          Length = 722

 Score =  446 bits (225), Expect = e-125
 Identities = 225/225 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggacaagagcaaatgatcagaaaaaagttgaggaattaatggatagtattgctgaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 196 atgaggacaagagcaaatgatcagaaaaaagttgaggaattaatggatagtattgctgaa 255

                                                                       
Query: 61  attggtctgcaagtgcctattgacgtccttgaggtcgatggggtctactatggtttctct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 attggtctgcaagtgcctattgacgtccttgaggtcgatggggtctactatggtttctct 315

                                                                       
Query: 121 ggctgtcaccgctacgaggctcaccagcgccttggactccccaccatccgttgcaaaatt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 316 ggctgtcaccgctacgaggctcaccagcgccttggactccccaccatccgttgcaaaatt 375

                                                        
Query: 181 cgccgtggtacaaaagagactctaaggcatcatttgcgctgaaaa 225
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 cgccgtggtacaaaagagactctaaggcatcatttgcgctgaaaa 420