Miyakogusa Predicted Gene

Lj4g3v0633540.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0633540.1 tr|G8XUV3|G8XUV3_CUCSA Si transport-like protein
1 OS=Cucumis sativus PE=2 SV=1,31.93,0.002,NODULIN-26-RELATED,NULL;
AQUAPORIN TRANSPORTER,Major intrinsic protein; no
description,Aquaporin-lik,gene.g53005.t1.1
         (693 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-...    56   3e-07
gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunct...    52   5e-06

>gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-like major intrinsic
           protein; n=1; Pisum sativum|Rep: Nodulin26-like major
           intrinsic protein - Pisum sativum (Garden pea), partial
           (86%)
          Length = 1238

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 107 tagcagaggttatagggacatacttcttggtatttgcagggtgt 150
           ||||||||||  | ||||||||||||||| ||||||||||||||
Sbjct: 426 tagcagaggtggtggggacatacttcttgatatttgcagggtgt 469


>gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunctional aquaporin;
           n=1; Medicago truncatula|Rep: Multifunctional aquaporin
           - Medicago truncatula (Barrel medic), partial (79%)
          Length = 1225

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 121 gggacatacttcttggtatttgcagggtgt 150
           ||||| ||||||||||||||||||||||||
Sbjct: 232 gggacctacttcttggtatttgcagggtgt 261