Miyakogusa Predicted Gene
- Lj4g3v0633470.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0633470.1 Non Chatacterized Hit- tr|I1ND75|I1ND75_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.21289
PE,82.89,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
Mem_trans,Auxin efflux carrier; seg,NULL; 2a69: aux,CUFF.47785.1
(1941 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66383 homologue to UniRef100_Q8GV76 Cluster: Auxin ef... 141 2e-32
gnl|LJGI|GO027806 homologue to UniRef100_Q8H0E0 Cluster: PIN1-li... 139 7e-32
gnl|LJGI|TC62842 homologue to UniRef100_A7PT87 Cluster: Chromoso... 119 7e-26
gnl|LJGI|FS335769 homologue to UniRef100_A2Q4I5 Cluster: Auxin E... 101 2e-20
gnl|LJGI|TC59920 homologue to UniRef100_A2Q4I5 Cluster: Auxin Ef... 101 2e-20
gnl|LJGI|FS353913 homologue to UniRef100_Q84YG8 Cluster: Auxin e... 60 5e-08
>gnl|LJGI|TC66383 homologue to UniRef100_Q8GV76 Cluster: Auxin efflux carrier
protein; n=1; Medicago truncatula|Rep: Auxin efflux
carrier protein - Medicago truncatula (Barrel medic),
partial (23%)
Length = 707
Score = 141 bits (71), Expect = 2e-32
Identities = 314/395 (79%)
Strand = Plus / Plus
Query: 61 atgatcctagcgtacggctctgtccggtggtggaagattttctccccggaccagtgctcc 120
|||||| |||| || || |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 311 atgatcttagcatatggttctgtccgttggtggaagatattctcaccggaccaatgttcc 370
Query: 121 ggcataaaccgtttcgtggcgatcttcgctgtgccgctgctctccttccacttcatctcc 180
|||||||||||||||||||| | ||||| || || || || |||||||| ||||| |||
Sbjct: 371 ggcataaaccgtttcgtggccgtattcgcggttccactcctttccttccatttcatttcc 430
Query: 181 accaacaacccgtacaccatgaacctccggttcatcgccgccgacacgctgcagaaggtg 240
||||||||||| ||| |||||| || |||||||||| || || || || ||||| |
Sbjct: 431 accaacaacccttacgaaatgaacttcaggttcatcgctgcagatacacttcagaaaata 490
Query: 241 atcatgctgttcgcactcacaatctggaccaatttcaccgccaacggcagcctggagtgg 300
|||||||| || || | | ||||| ||||||||| || || ||||| || |||
Sbjct: 491 atcatgctctttgccttgtttctgtggacaaatttcaccaaaaatggtagccttgaatgg 550
Query: 301 atgatcaccatcttctccctgtccacattgcccaacacgcttgtcatgggaattccactc 360
||||||||||||||||| || |||| |||||||||| || |||||||| || || |
Sbjct: 551 atgatcaccatcttctctcttaccactctgcccaacaccctcgtcatggggatccccttg 610
Query: 361 ctcatcgccatgtacggcgaatactccggcgagcttatggtccaggtggtggtcctccag 420
| ||||| ||||||||||| ||||| ||| || |||||||| ||||| || |||||
Sbjct: 611 ttaatcgctatgtacggcgattactcgggcaccctcatggtccaagtggttgtactccaa 670
Query: 421 tgcatcatttggtacacgctgctcctcttcctctt 455
|||||||| |||||||| || ||| | ||||||||
Sbjct: 671 tgcatcatatggtacaccctcctcttattcctctt 705
>gnl|LJGI|GO027806 homologue to UniRef100_Q8H0E0 Cluster: PIN1-like auxin transport
protein; n=1; Cucumis sativus|Rep: PIN1-like auxin
transport protein - Cucumis sativus (Cucumber), partial
(27%)
Length = 766
Score = 139 bits (70), Expect = 7e-32
Identities = 244/302 (80%)
Strand = Plus / Minus
Query: 1591 tccatactgtctgatgctggtcttggaatggctatgtttagcttaggcttgtttatggct 1650
|||||| |||| ||||| || || || ||||| |||||||| | || ||||| ||||||
Sbjct: 517 tccatattgtcagatgcagggctcggcatggccatgtttagtcttgggttgttcatggct 458
Query: 1651 cttcaacccaagatgattgcatgtgggaactcagtggctacatttgctatggctgttcga 1710
| ||||| |||||||| |||||||| || || | || | ||| | |||||||| ||
Sbjct: 457 ttgcaaccaaagatgatagcatgtggaaattccatagcagctttttcaatggctgtgaga 398
Query: 1711 tttcttacaggtcctgcagttatggcagcagcttccattgctgttggcctgcgtggcacc 1770
|| ||||||||||| || || |||||||| ||||||||||||||||| || | ||
Sbjct: 397 ttccttacaggtccggctgtcatggcagctgcttccattgctgttggactcagaggtgtt 338
Query: 1771 ctcttacgtatagctattgttcaggctgcacttcctcaaggaattgttccatttgtgttt 1830
||||||| | || ||||||||||| || ||||| ||||||||||| ||||||||||||
Sbjct: 337 ctcttacacgttgccattgttcaggcagctcttccacaaggaattgtcccatttgtgttt 278
Query: 1831 gccaaggagtacaatgtccatccggccattcttagcacaggggttatatttgggatgttg 1890
|||||||| |||||||| ||||| | |||||||| ||||| ||||| ||||||||||||
Sbjct: 277 gccaaggaatacaatgtacatcctgatattcttagtacaggtgttatttttgggatgttg 218
Query: 1891 at 1892
||
Sbjct: 217 at 216
>gnl|LJGI|TC62842 homologue to UniRef100_A7PT87 Cluster: Chromosome chr8 scaffold_29,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_29, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (31%)
Length = 785
Score = 119 bits (60), Expect = 7e-26
Identities = 270/340 (79%)
Strand = Plus / Plus
Query: 1583 aatcaatctccatactgtctgatgctggtcttggaatggctatgtttagcttaggcttgt 1642
||||||| || || || |||||||| || ||||||||||| |||||||| | || ||||
Sbjct: 191 aatcaatatcaattctatctgatgcaggccttggaatggcaatgtttagtcttgggttgt 250
Query: 1643 ttatggctcttcaacccaagatgattgcatgtgggaactcagtggctacatttgctatgg 1702
| ||||| | || || ||||| ||||| ||||| ||||| || ||| ||||| ||||||
Sbjct: 251 tcatggcgttgcagccaaagatcattgcttgtggaaactcggttgctgcatttactatgg 310
Query: 1703 ctgttcgatttcttacaggtcctgcagttatggcagcagcttccattgctgttggcctgc 1762
| ||||| || || || || |||||||| ||||| | ||||| |||| ||| || ||
Sbjct: 311 cagttcggttcctcactggccctgcagtcatggccgttgcttcaattgttgtagggctca 370
Query: 1763 gtggcaccctcttacgtatagctattgttcaggctgcacttcctcaaggaattgttccat 1822
| || || || | ||||||||||| |||||||| | |||||||||||||| ||||
Sbjct: 371 ggggtgttctgttgcacatagctattgtacaggctgctttgcctcaaggaattgtcccat 430
Query: 1823 ttgtgtttgccaaggagtacaatgtccatccggccattcttagcacaggggttatatttg 1882
|||||||||| ||||| |||||||| ||||| | |||| | ||||| |||||||||||||
Sbjct: 431 ttgtgtttgctaaggaatacaatgttcatcctgacattttcagcactggggttatatttg 490
Query: 1883 ggatgttgatagctctaccaattacactagtgtactacat 1922
| ||| |||| ||||| || ||||| || || ||||||||
Sbjct: 491 gaatgctgattgctcttcccattactcttgtttactacat 530
>gnl|LJGI|FS335769 homologue to UniRef100_A2Q4I5 Cluster: Auxin Efflux Carrier; n=2;
Medicago truncatula|Rep: Auxin Efflux Carrier - Medicago
truncatula (Barrel medic), partial (26%)
Length = 665
Score = 101 bits (51), Expect = 2e-20
Identities = 138/167 (82%)
Strand = Plus / Plus
Query: 52 tacgtggctatgatcctagcgtacggctctgtccggtggtggaagattttctccccggac 111
||||||||||||||||| || |||||||| || |||||||| || ||| || |||
Sbjct: 277 tacgtggctatgatcctcgcctacggctcagtgaaatggtggaaaatcttcagtccagac 336
Query: 112 cagtgctccggcataaaccgtttcgtggcgatcttcgctgtgccgctgctctccttccac 171
|||||||| ||||| |||||||| || || | ||||| || || ||||| |||||||||
Sbjct: 337 cagtgctctggcatcaaccgttttgttgctctgttcgcagttcctctgctttccttccac 396
Query: 172 ttcatctccaccaacaacccgtacaccatgaacctccggttcatcgc 218
|||||||||||||||||||| ||| |||||||| | ||||||||||
Sbjct: 397 ttcatctccaccaacaacccctacgccatgaactacaggttcatcgc 443
>gnl|LJGI|TC59920 homologue to UniRef100_A2Q4I5 Cluster: Auxin Efflux Carrier; n=2;
Medicago truncatula|Rep: Auxin Efflux Carrier - Medicago
truncatula (Barrel medic), partial (34%)
Length = 760
Score = 101 bits (51), Expect = 2e-20
Identities = 138/167 (82%)
Strand = Plus / Plus
Query: 52 tacgtggctatgatcctagcgtacggctctgtccggtggtggaagattttctccccggac 111
||||||||||||||||| || |||||||| || |||||||| || ||| || |||
Sbjct: 222 tacgtggctatgatcctcgcctacggctcagtgaaatggtggaaaatcttcagtccagac 281
Query: 112 cagtgctccggcataaaccgtttcgtggcgatcttcgctgtgccgctgctctccttccac 171
|||||||| ||||| |||||||| || || | ||||| || || ||||| |||||||||
Sbjct: 282 cagtgctctggcatcaaccgttttgttgctctgttcgcagttcctctgctttccttccac 341
Query: 172 ttcatctccaccaacaacccgtacaccatgaacctccggttcatcgc 218
|||||||||||||||||||| ||| |||||||| | ||||||||||
Sbjct: 342 ttcatctccaccaacaacccctacgccatgaactacaggttcatcgc 388
>gnl|LJGI|FS353913 homologue to UniRef100_Q84YG8 Cluster: Auxin efflux carrier protein;
n=1; Medicago truncatula|Rep: Auxin efflux carrier
protein - Medicago truncatula (Barrel medic), partial
(11%)
Length = 477
Score = 60.0 bits (30), Expect = 5e-08
Identities = 81/98 (82%)
Strand = Plus / Minus
Query: 1786 attgttcaggctgcacttcctcaaggaattgttccatttgtgtttgccaaggagtacaat 1845
|||||||||||||| ||||| || || || ||||| ||||| |||||||| || ||||||
Sbjct: 423 attgttcaggctgctcttccccagggtatcgttccctttgtttttgccaaagaatacaat 364
Query: 1846 gtccatccggccattcttagcacaggggttatatttgg 1883
||||||| | || || || |||| ||||||||||||
Sbjct: 363 ctccatccagatatactcagtacagcggttatatttgg 326