Miyakogusa Predicted Gene

Lj4g3v0548830.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0548830.1 Non Chatacterized Hit- tr|I1JEX7|I1JEX7_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,74.31,0,KINESINHEAVY,Kinesin, motor domain; no
description,Kinesin, motor domain; Kinesin,Kinesin, motor
dom,CUFF.47580.1
         (8004 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO011769 similar to UniRef100_A7R3C2 Cluster: Chromosom...   254   7e-66

>gnl|LJGI|GO011769 similar to UniRef100_A7R3C2 Cluster: Chromosome undetermined
            scaffold_502, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_502, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (13%)
          Length = 615

 Score =  254 bits (128), Expect = 7e-66
 Identities = 128/128 (100%)
 Strand = Plus / Plus

                                                                        
Query: 3095 ggcaggctgaggctgaaactgctgaggtgattgtctgtatgcaggaagaacttgcccagc 3154
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    ggcaggctgaggctgaaactgctgaggtgattgtctgtatgcaggaagaacttgcccagc 60

                                                                        
Query: 3155 tccaggttcaggtaaatgatagtcatgtgaaggaaatggaaatgaaagagagtatacttc 3214
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   tccaggttcaggtaaatgatagtcatgtgaaggaaatggaaatgaaagagagtatacttc 120

                    
Query: 3215 gtttggaa 3222
            ||||||||
Sbjct: 121  gtttggaa 128