Miyakogusa Predicted Gene

Lj4g3v0510080.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0510080.1 Non Chatacterized Hit- tr|I1KSD4|I1KSD4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.45343
PE,77.53,0,Serine/Threonine protein kinases,
catalytic,Serine/threonine- / dual-specificity protein kinase,
cat,CUFF.47528.1
         (690 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP030572 similar to UniRef100_A7QE85 Cluster: Chromosom...   246   2e-64
gnl|LJGI|GO011403 similar to UniRef100_Q39027 Cluster: Mitogen-a...   119   2e-26
gnl|LJGI|FS326997 similar to UniRef100_Q39027 Cluster: Mitogen-a...   117   9e-26
gnl|LJGI|TC67623 homologue to UniRef100_Q9M6R8 Cluster: MAP kina...    66   3e-10
gnl|LJGI|TC72344 similar to UniRef100_P93321 Cluster: Cdc2MsD pr...    62   5e-09
gnl|LJGI|TC79792 homologue to UniRef100_A7PKQ6 Cluster: Chromoso...    60   2e-08
gnl|LJGI|TC58473 homologue to UniRef100_A7PKQ6 Cluster: Chromoso...    60   2e-08

>gnl|LJGI|BP030572 similar to UniRef100_A7QE85 Cluster: Chromosome chr4 scaffold_83,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_83, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (31%)
          Length = 507

 Score =  246 bits (124), Expect = 2e-64
 Identities = 273/323 (84%)
 Strand = Plus / Minus

                                                                       
Query: 340 caggatgaatctgatcttgactttattgataatccgagatcgaggagtttcatcgaatca 399
           ||||||||  |||||||||| ||||| |||||||||| |   ||||| |||||| || ||
Sbjct: 490 caggatgatcctgatcttgagtttatcgataatccgaaagncaggagattcatcaaaaca 431

                                                                       
Query: 400 cttccctatagaaggggcatagagttctctcagctatatccacaagctgatccattggca 459
           ||||||| || | |||||| | | |||||||||||||| |||||||| ||||||||||| 
Sbjct: 430 cttccctttacacggggcaaacacttctctcagctatacccacaagcagatccattggcc 371

                                                                       
Query: 460 attgatttgctgcaaagattgcttgtatttcacccagctaaaagaatcactgcctcagaa 519
           || ||||||||||||| | ||||||||||| | ||  |||||||||| |||| || ||||
Sbjct: 370 atagatttgctgcaaaaaatgcttgtatttgatcccactaaaagaattactgtcttagaa 311

                                                                       
Query: 520 gcacttcaacatccatattttgctggtatatttgatccaatgcgtgagcctcctgctcag 579
           |||||||||||||||||| | ||||   ||| |||||||| | || | ||||||||||||
Sbjct: 310 gcacttcaacatccatatatagctgacctatatgatccaaggtgtaatcctcctgctcag 251

                                                                       
Query: 580 gttcccatcaaaattgacatagttgaaagtaggaaagaagagattatcagggaaatgatg 639
           ||||| |||||  ||||||| | |||||||  ||| ||||||||||| ||||||||||||
Sbjct: 250 gttcctatcaatcttgacatggatgaaagtgagaatgaagagattattagggaaatgatg 191

                                  
Query: 640 tggaatgagatgcttcattatca 662
           ||||||||||||||| |||||||
Sbjct: 190 tggaatgagatgcttaattatca 168


>gnl|LJGI|GO011403 similar to UniRef100_Q39027 Cluster: Mitogen-activated protein
           kinase 7; n=2; Arabidopsis thaliana|Rep:
           Mitogen-activated protein kinase 7 - Arabidopsis
           thaliana (Mouse-ear cress), partial (46%)
          Length = 755

 Score =  119 bits (60), Expect = 2e-26
 Identities = 104/116 (89%), Gaps = 2/116 (1%)
 Strand = Plus / Plus

                                                                       
Query: 4   cagctgcttcaaggtcttgaatatcttcactctgcaaagattcttcatcgtgacctgaag 63
           |||||||||| ||||||| |||||||||| |||||||| |||||||| || ||||||| |
Sbjct: 642 cagctgcttcgaggtcttaaatatcttcattctgcaaacattcttcaccgggacctga-g 700

                                                                   
Query: 64  cctgggaatctgcttgtgaatgccaattgtgacttgaagatatgtgacttcgggct 119
           ||||||||| ||||||| |||||||||||||||||| |||| |||||||| |||||
Sbjct: 701 cctgggaatttgcttgtcaatgccaattgtgacttg-agatttgtgactttgggct 755


>gnl|LJGI|FS326997 similar to UniRef100_Q39027 Cluster: Mitogen-activated protein
           kinase 7; n=2; Arabidopsis thaliana|Rep:
           Mitogen-activated protein kinase 7 - Arabidopsis
           thaliana (Mouse-ear cress), partial (45%)
          Length = 778

 Score =  117 bits (59), Expect = 9e-26
 Identities = 83/91 (91%)
 Strand = Plus / Plus

                                                                       
Query: 4   cagctgcttcaaggtcttgaatatcttcactctgcaaagattcttcatcgtgacctgaag 63
           |||||||||| ||||||| |||||||||| |||||||| |||||||| || |||||||||
Sbjct: 688 cagctgcttcgaggtcttaaatatcttcattctgcaaacattcttcaccgggacctgaag 747

                                          
Query: 64  cctgggaatctgcttgtgaatgccaattgtg 94
           ||||||||| ||||||| |||||||||||||
Sbjct: 748 cctgggaatttgcttgtcaatgccaattgtg 778


>gnl|LJGI|TC67623 homologue to UniRef100_Q9M6R8 Cluster: MAP kinase PsMAPK2; n=1; Pisum
            sativum|Rep: MAP kinase PsMAPK2 - Pisum sativum (Garden
            pea), complete
          Length = 1821

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 117/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 146  agttcatgacagagtatgttgttactcgatggtatcgcgcaccagaacttctgttatgca 205
            |||||||||| ||||||||||| |||||||||||| | || ||||| |||||  | ||| 
Sbjct: 903  agttcatgactgagtatgttgtcactcgatggtatagggcgccagagcttctactctgct 962

                                                                        
Query: 206  gtgatgattatggaacttctgttgatatgtggtctgtaggatgcatttttgctgagattc 265
            | ||  | ||||| || ||| ||||| ||||||| || |||||||| ||||| ||| |||
Sbjct: 963  gcgacaactatgggacgtctattgatgtgtggtcagtgggatgcatatttgcagagcttc 1022

                                     
Query: 266  ttggtagaaagcctatcttcactgg 290
            ||||  |||| ||||| ||| ||||
Sbjct: 1023 ttgggcgaaaacctattttccctgg 1047



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 616  gaagagattatcagggaaatgatgtggaatgagatgcttcattatcatcct 666
            |||||||| || ||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 1373 gaagagatgataagggagatgatgtggaaggaaatgcttcattaccatcct 1423


>gnl|LJGI|TC72344 similar to UniRef100_P93321 Cluster: Cdc2MsD protein; n=1; Medicago
           sativa|Rep: Cdc2MsD protein - Medicago sativa (Alfalfa),
           complete
          Length = 1393

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 225 tgttgatatgtggtctgtaggatgcatttttgctgagat 263
           |||||||||||||||||| || |||||||||||||||||
Sbjct: 776 tgttgatatgtggtctgttggttgcatttttgctgagat 814


>gnl|LJGI|TC79792 homologue to UniRef100_A7PKQ6 Cluster: Chromosome chr7 scaffold_20,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_20, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (61%)
          Length = 1117

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 224 ctgttgatatgtggtctgtaggatgcatttttgctgag 261
           |||||||||||||| |||| ||||||||||||||||||
Sbjct: 577 ctgttgatatgtgggctgtgggatgcatttttgctgag 614


>gnl|LJGI|TC58473 homologue to UniRef100_A7PKQ6 Cluster: Chromosome chr7 scaffold_20,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_20, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (67%)
          Length = 1082

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 224 ctgttgatatgtggtctgtaggatgcatttttgctgag 261
           |||||||||||||| |||| ||||||||||||||||||
Sbjct: 725 ctgttgatatgtgggctgtgggatgcatttttgctgag 762