Miyakogusa Predicted Gene

Lj4g3v0496480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0496480.1 Non Chatacterized Hit- tr|I1M044|I1M044_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,79.22,0,no
description,NULL; FAMILY NOT NAMED,NULL; PEROXIDASE_1,Peroxidases
heam-ligand binding site; PEROX,CUFF.47490.1
         (1008 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO013008 similar to UniRef100_A2Q692 Cluster: Haem pero...    52   7e-06
gnl|LJGI|TC58346 similar to UniRef100_A2Q692 Cluster: Haem perox...    52   7e-06

>gnl|LJGI|GO013008 similar to UniRef100_A2Q692 Cluster: Haem peroxidase,
           plant/fungal/bacterial; n=1; Medicago truncatula|Rep:
           Haem peroxidase, plant/fungal/bacterial - Medicago
           truncatula (Barrel medic), partial (30%)
          Length = 543

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 197 ttcgtcttctcttccatgattgctttgtagaaggatgtgatgcttcaatt 246
           |||| |||| ||||||||||||||||||| | || ||||||| |||||||
Sbjct: 219 ttcggcttcacttccatgattgctttgtaaatggttgtgatggttcaatt 268


>gnl|LJGI|TC58346 similar to UniRef100_A2Q692 Cluster: Haem peroxidase,
           plant/fungal/bacterial; n=1; Medicago truncatula|Rep:
           Haem peroxidase, plant/fungal/bacterial - Medicago
           truncatula (Barrel medic), partial (84%)
          Length = 1165

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 197 ttcgtcttctcttccatgattgctttgtagaaggatgtgatgcttcaatt 246
           |||| |||| ||||||||||||||||||| | || ||||||| |||||||
Sbjct: 219 ttcggcttcacttccatgattgctttgtaaatggttgtgatggttcaatt 268