Miyakogusa Predicted Gene

Lj4g3v0473190.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0473190.1 CUFF.47345.1
         (336 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63935 similar to UniRef100_P05478 Cluster: 18.5 kDa c...   666   0.0  
gnl|LJGI|GO025194 similar to UniRef100_P05478 Cluster: 18.5 kDa ...   180   4e-45
gnl|LJGI|BW594343 similar to UniRef100_Q6WHC0 Cluster: Chloropla...   107   4e-23
gnl|LJGI|TC71900 similar to UniRef100_A1E463 Cluster: 17.7 KD cl...    54   6e-07

>gnl|LJGI|TC63935 similar to UniRef100_P05478 Cluster: 18.5 kDa class I heat shock
           protein; n=1; Glycine max|Rep: 18.5 kDa class I heat
           shock protein - Glycine max (Soybean), partial (98%)
          Length = 756

 Score =  666 bits (336), Expect = 0.0
 Identities = 336/336 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacagagttcttcagattagcggagagaggaatgttgagaaggaagacaagaatgata 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 atgacagagttcttcagattagcggagagaggaatgttgagaaggaagacaagaatgata 415

                                                                       
Query: 61  catggcatcgcgtggagcgtagcagtgggaaattccagaggaggttcagattgcctgaga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 catggcatcgcgtggagcgtagcagtgggaaattccagaggaggttcagattgcctgaga 475

                                                                       
Query: 121 atgctaaaatggatcaagttaaggcttccatggagaatggggttctcactgttactgtcc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 476 atgctaaaatggatcaagttaaggcttccatggagaatggggttctcactgttactgtcc 535

                                                                       
Query: 181 ccaaggaagagatcaagaagcctgaagttaagtccattgaaatctctggttgaacaaaat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 536 ccaaggaagagatcaagaagcctgaagttaagtccattgaaatctctggttgaacaaaat 595

                                                                       
Query: 241 gaactatatgttactctgtttttgggtatcctgttttggtctactctgttatgttgttgc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 gaactatatgttactctgtttttgggtatcctgttttggtctactctgttatgttgttgc 655

                                               
Query: 301 tttgttggtttgtatcgtatgtctttttggttgtaa 336
           ||||||||||||||||||||||||||||||||||||
Sbjct: 656 tttgttggtttgtatcgtatgtctttttggttgtaa 691


>gnl|LJGI|GO025194 similar to UniRef100_P05478 Cluster: 18.5 kDa class I heat shock
           protein; n=1; Glycine max|Rep: 18.5 kDa class I heat
           shock protein - Glycine max (Soybean), partial (68%)
          Length = 527

 Score =  180 bits (91), Expect = 4e-45
 Identities = 94/95 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacagagttcttcagattagcggagagaggaatgttgagaaggaagacaagaatgata 60
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 433 atgacagagttcttcagattagcggagagaggaatgttgagaaggaaggcaagaatgata 492

                                              
Query: 61  catggcatcgcgtggagcgtagcagtgggaaattc 95
           |||||||||||||||||||||||||||||||||||
Sbjct: 493 catggcatcgcgtggagcgtagcagtgggaaattc 527


>gnl|LJGI|BW594343 similar to UniRef100_Q6WHC0 Cluster: Chloroplast small heat shock
           protein class I; n=1; Capsicum frutescens|Rep:
           Chloroplast small heat shock protein class I - Capsicum
           frutescens (Cayenne pepper) (Tabasco pepper), partial
           (89%)
          Length = 481

 Score =  107 bits (54), Expect = 4e-23
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                       
Query: 98  gaggaggttcagattgcctgagaatgctaaaatggatcaagttaaggcttccatggagaa 157
           |||||||||| |  |||| |||||||||||||||||||| ||||||||| ||||||||||
Sbjct: 381 gaggaggttccggctgccggagaatgctaaaatggatcaggttaaggctgccatggagaa 440

                                         
Query: 158 tggggttctcactgttactgtccccaagga 187
           |||||| |||||||||||||| || |||||
Sbjct: 441 tggggtgctcactgttactgtgcctaagga 470


>gnl|LJGI|TC71900 similar to UniRef100_A1E463 Cluster: 17.7 KD class I small
           heat-shock protein; n=1; Ageratina adenophora|Rep: 17.7
           KD class I small heat-shock protein - Ageratina
           adenophora, partial (86%)
          Length = 502

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 117 gagaatgctaaaatggatcaagttaaggcttccatggagaatggggt 163
           ||||||||||| ||||| || ||||||||| | ||||||||||||||
Sbjct: 455 gagaatgctaagatggagcaggttaaggctgctatggagaatggggt 501