Miyakogusa Predicted Gene

Lj4g3v0451290.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0451290.1 tr|I1KLK0|I1KLK0_SOYBN Lipoxygenase OS=Glycine
max GN=Gma.52156 PE=3 SV=1,82.21,0,LIPOXYGENASE,Lipoxygenase,
C-terminal; Lipoxigenase,Lipoxygenase, C-terminal;
Lipoxygenase,Lipoxygen,CUFF.47272.1
         (1185 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78888 similar to UniRef100_A7LCD6 Cluster: Lipoxygena...    52   8e-06

>gnl|LJGI|TC78888 similar to UniRef100_A7LCD6 Cluster: Lipoxygenase-10; n=1; Glycine
           max|Rep: Lipoxygenase-10 - Glycine max (Soybean),
           partial (46%)
          Length = 1480

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 457 catggcattagacttcttattgaagattatccttatgcagttgatggact 506
           ||||||||| | || || |||||||||||||||||||| | |||||||||
Sbjct: 552 catggcattcgcctgctgattgaagattatccttatgctgctgatggact 601