Miyakogusa Predicted Gene
- Lj4g3v0451150.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0451150.1 tr|F2DQ57|F2DQ57_HORVD Predicted protein
OS=Hordeum vulgare var. distichum PE=2 SV=1,50,4e-19,ZF_RING_1,Zinc
finger, RING-type, conserved site; zf-C3HC4_2,NULL; ZF_RING_2,Zinc
finger, RING-type;,CUFF.47260.1
(666 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58834 similar to UniRef100_Q6R567 Cluster: Ring domai... 1312 0.0
gnl|LJGI|TC65023 similar to UniRef100_Q6R567 Cluster: Ring domai... 159 3e-38
gnl|LJGI|TC58364 74 1e-12
gnl|LJGI|TC79154 similar to UniRef100_Q6R567 Cluster: Ring domai... 64 1e-09
gnl|LJGI|TC77747 similar to UniRef100_Q6R567 Cluster: Ring domai... 64 1e-09
gnl|LJGI|TC75097 similar to UniRef100_Q6R567 Cluster: Ring domai... 64 1e-09
gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domai... 62 5e-09
>gnl|LJGI|TC58834 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (24%)
Length = 975
Score = 1312 bits (662), Expect = 0.0
Identities = 665/666 (99%)
Strand = Plus / Plus
Query: 1 atggcctttgagcactatcttacccaggaatgggaaggatcagagacagagacagtaagt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 atggcctttgagcactatcttacccaggaatgggaaggatcagagacagagacagtaagt 214
Query: 61 tgtgatggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgact 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tgtgatggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgact 274
Query: 121 ctatgtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgct 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 ctatgtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgct 334
Query: 181 tctcttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacaca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 tctcttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacaca 394
Query: 241 acaatggttcctctctatggtcgtggcccaagtgactctaatttgaaggtacaacataaa 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 acaatggttcctctctatggtcgtggcccaagtgactctaatttgaaggtacaacataaa 454
Query: 301 gatgttttgataccaccaagaccaacttgttctggtgctaaatctctctttgcagcatct 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gatgttttgataccaccaagaccaacttgttctggtgctaaatctctctttgcagcatct 514
Query: 361 tctcaaagtagtggccagcagcttccatatcgcaatccttatcagaatcaagatttcaat 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 tctcaaagtagtggccagcagcttccatatcgcaatccttatcagaatcaagatttcaat 574
Query: 421 caagaagaggagcatgatgatgagacatctcaacaaatggtcactaatcttggtggtgct 480
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 575 caagaagaggagcatgatgatgaggcatctcaacaaatggtcactaatcttggtggtgct 634
Query: 481 accatggcaacaggattcccccaccttgtgtttgggatgtttggggtgggaagctcagca 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 accatggcaacaggattcccccaccttgtgtttgggatgtttggggtgggaagctcagca 694
Query: 541 aattcatacaacaacccaaattcacctcccaggtttagaaggctagagatgcaggctgac 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 695 aattcatacaacaacccaaattcacctcccaggtttagaaggctagagatgcaggctgac 754
Query: 601 aaatcattgaacagaatttcaatttttctcctttgctgctttcttctatgtctcattgtg 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 755 aaatcattgaacagaatttcaatttttctcctttgctgctttcttctatgtctcattgtg 814
Query: 661 ttctga 666
||||||
Sbjct: 815 ttctga 820
>gnl|LJGI|TC65023 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (24%)
Length = 1026
Score = 159 bits (80), Expect = 3e-38
Identities = 158/184 (85%)
Strand = Plus / Plus
Query: 65 atggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctat 124
||||| |||| |||||||| |||||||| || | ||||| ||||| || || || || |
Sbjct: 188 atggttgtttcgattgcaacatctgcttagacatcgcacacgaaccggtagtcaccctct 247
Query: 125 gtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgcttctc 184
|||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||
Sbjct: 248 gtggtcacctttactgctggccctgcatctacaagtggctacatgtccaaagtgattctc 307
Query: 185 ttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacacaacaa 244
| ||||||||||||| ||||||||||||||||| |||| || |||||| |||| ||||
Sbjct: 308 tcgcacctgatgagcatccacaatgccctgtttgtaaggttgacatatcccacagcacaa 367
Query: 245 tggt 248
||||
Sbjct: 368 tggt 371
Score = 85.7 bits (43), Expect = 3e-16
Identities = 64/71 (90%)
Strand = Plus / Plus
Query: 577 agaaggctagagatgcaggctgacaaatcattgaacagaatttcaatttttctcctttgc 636
||||||| |||||||||||| ||||||| |||||||||||||||||||||||| | |||
Sbjct: 763 agaaggcaagagatgcaggcagacaaatttttgaacagaatttcaatttttctcttgtgc 822
Query: 637 tgctttcttct 647
|||||| ||||
Sbjct: 823 tgcttttttct 833
>gnl|LJGI|TC58364
Length = 1277
Score = 73.8 bits (37), Expect = 1e-12
Identities = 85/101 (84%)
Strand = Plus / Plus
Query: 65 atggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctat 124
||||| |||||||||||||||| |||||||| | || ||||| || ||||| || ||||
Sbjct: 300 atggttgttttgattgcaatatttgcttggaatcagcgcatgatcctgtggtcacgctat 359
Query: 125 gtggtcacctttactgctggccctgcatctacaagtggctc 165
| ||||| || ||||||||||| ||||| ||||| ||||||
Sbjct: 360 gcggtcatctgtactgctggccatgcatatacaaatggctc 400
>gnl|LJGI|TC79154 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (44%)
Length = 1137
Score = 63.9 bits (32), Expect = 1e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
|||||||| ||||| ||||| || |||||||||||||||||||| ||||| |||||
Sbjct: 382 ccagtggtcactctctgtggccatctttactgctggccctgcatttacaaatggct 437
>gnl|LJGI|TC77747 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (27%)
Length = 413
Score = 63.9 bits (32), Expect = 1e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
|||||||| ||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 106 ccagtggttactctttgtggtcatctttattgctggccctgcatttacaaatggct 161
>gnl|LJGI|TC75097 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (44%)
Length = 1190
Score = 63.9 bits (32), Expect = 1e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
|||||||| ||||| ||||| || |||||||||||||||||||| ||||| |||||
Sbjct: 384 ccagtggtcactctctgtggccatctttactgctggccctgcatttacaaatggct 439
>gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domain containing
protein; n=1; Capsicum annuum|Rep: Ring domain
containing protein - Capsicum annuum (Bell pepper),
partial (58%)
Length = 1040
Score = 61.9 bits (31), Expect = 5e-09
Identities = 82/99 (82%)
Strand = Plus / Plus
Query: 66 tggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctatg 125
|||||| ||||||||||| |||||||| || | || || || |||||||| ||||| ||
Sbjct: 276 tggtggctttgattgcaacatctgcttagactgtgtgcaagatccagtggttactctgtg 335
Query: 126 tggtcacctttactgctggccctgcatctacaagtggct 164
|||||| || || || ||||||||||| ||||| |||||
Sbjct: 336 tggtcatctctattgttggccctgcatttacaaatggct 374