Miyakogusa Predicted Gene

Lj4g3v0451150.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0451150.1 tr|F2DQ57|F2DQ57_HORVD Predicted protein
OS=Hordeum vulgare var. distichum PE=2 SV=1,50,4e-19,ZF_RING_1,Zinc
finger, RING-type, conserved site; zf-C3HC4_2,NULL; ZF_RING_2,Zinc
finger, RING-type;,CUFF.47260.1
         (666 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58834 similar to UniRef100_Q6R567 Cluster: Ring domai...  1312   0.0  
gnl|LJGI|TC65023 similar to UniRef100_Q6R567 Cluster: Ring domai...   159   3e-38
gnl|LJGI|TC58364                                                       74   1e-12
gnl|LJGI|TC79154 similar to UniRef100_Q6R567 Cluster: Ring domai...    64   1e-09
gnl|LJGI|TC77747 similar to UniRef100_Q6R567 Cluster: Ring domai...    64   1e-09
gnl|LJGI|TC75097 similar to UniRef100_Q6R567 Cluster: Ring domai...    64   1e-09
gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domai...    62   5e-09

>gnl|LJGI|TC58834 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (24%)
          Length = 975

 Score = 1312 bits (662), Expect = 0.0
 Identities = 665/666 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcctttgagcactatcttacccaggaatgggaaggatcagagacagagacagtaagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 atggcctttgagcactatcttacccaggaatgggaaggatcagagacagagacagtaagt 214

                                                                       
Query: 61  tgtgatggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgact 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tgtgatggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgact 274

                                                                       
Query: 121 ctatgtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 ctatgtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgct 334

                                                                       
Query: 181 tctcttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 tctcttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacaca 394

                                                                       
Query: 241 acaatggttcctctctatggtcgtggcccaagtgactctaatttgaaggtacaacataaa 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 acaatggttcctctctatggtcgtggcccaagtgactctaatttgaaggtacaacataaa 454

                                                                       
Query: 301 gatgttttgataccaccaagaccaacttgttctggtgctaaatctctctttgcagcatct 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 gatgttttgataccaccaagaccaacttgttctggtgctaaatctctctttgcagcatct 514

                                                                       
Query: 361 tctcaaagtagtggccagcagcttccatatcgcaatccttatcagaatcaagatttcaat 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 tctcaaagtagtggccagcagcttccatatcgcaatccttatcagaatcaagatttcaat 574

                                                                       
Query: 421 caagaagaggagcatgatgatgagacatctcaacaaatggtcactaatcttggtggtgct 480
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 575 caagaagaggagcatgatgatgaggcatctcaacaaatggtcactaatcttggtggtgct 634

                                                                       
Query: 481 accatggcaacaggattcccccaccttgtgtttgggatgtttggggtgggaagctcagca 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 accatggcaacaggattcccccaccttgtgtttgggatgtttggggtgggaagctcagca 694

                                                                       
Query: 541 aattcatacaacaacccaaattcacctcccaggtttagaaggctagagatgcaggctgac 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 695 aattcatacaacaacccaaattcacctcccaggtttagaaggctagagatgcaggctgac 754

                                                                       
Query: 601 aaatcattgaacagaatttcaatttttctcctttgctgctttcttctatgtctcattgtg 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 755 aaatcattgaacagaatttcaatttttctcctttgctgctttcttctatgtctcattgtg 814

                 
Query: 661 ttctga 666
           ||||||
Sbjct: 815 ttctga 820


>gnl|LJGI|TC65023 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (24%)
          Length = 1026

 Score =  159 bits (80), Expect = 3e-38
 Identities = 158/184 (85%)
 Strand = Plus / Plus

                                                                       
Query: 65  atggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctat 124
           ||||| |||| |||||||| |||||||| ||  | ||||| ||||| || || || || |
Sbjct: 188 atggttgtttcgattgcaacatctgcttagacatcgcacacgaaccggtagtcaccctct 247

                                                                       
Query: 125 gtggtcacctttactgctggccctgcatctacaagtggctctatgtgcaaagtgcttctc 184
           ||||||||||||||||||||||||||||||||||||||||  |||| ||||||| |||||
Sbjct: 248 gtggtcacctttactgctggccctgcatctacaagtggctacatgtccaaagtgattctc 307

                                                                       
Query: 185 ttgcacctgatgagccaccacaatgccctgtttgcaaggatggcatatcacacacaacaa 244
           | |||||||||||||  ||||||||||||||||| |||| || |||||| ||||  ||||
Sbjct: 308 tcgcacctgatgagcatccacaatgccctgtttgtaaggttgacatatcccacagcacaa 367

               
Query: 245 tggt 248
           ||||
Sbjct: 368 tggt 371



 Score = 85.7 bits (43), Expect = 3e-16
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 577 agaaggctagagatgcaggctgacaaatcattgaacagaatttcaatttttctcctttgc 636
           ||||||| |||||||||||| |||||||  |||||||||||||||||||||||| | |||
Sbjct: 763 agaaggcaagagatgcaggcagacaaatttttgaacagaatttcaatttttctcttgtgc 822

                      
Query: 637 tgctttcttct 647
           |||||| ||||
Sbjct: 823 tgcttttttct 833


>gnl|LJGI|TC58364 
          Length = 1277

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 65  atggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctat 124
           ||||| |||||||||||||||| |||||||| |  || ||||| || ||||| || ||||
Sbjct: 300 atggttgttttgattgcaatatttgcttggaatcagcgcatgatcctgtggtcacgctat 359

                                                    
Query: 125 gtggtcacctttactgctggccctgcatctacaagtggctc 165
           | ||||| || ||||||||||| ||||| ||||| ||||||
Sbjct: 360 gcggtcatctgtactgctggccatgcatatacaaatggctc 400


>gnl|LJGI|TC79154 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (44%)
          Length = 1137

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
           |||||||| ||||| ||||| || |||||||||||||||||||| ||||| |||||
Sbjct: 382 ccagtggtcactctctgtggccatctttactgctggccctgcatttacaaatggct 437


>gnl|LJGI|TC77747 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (27%)
          Length = 413

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
           |||||||| ||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 106 ccagtggttactctttgtggtcatctttattgctggccctgcatttacaaatggct 161


>gnl|LJGI|TC75097 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (44%)
          Length = 1190

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 109 ccagtggtgactctatgtggtcacctttactgctggccctgcatctacaagtggct 164
           |||||||| ||||| ||||| || |||||||||||||||||||| ||||| |||||
Sbjct: 384 ccagtggtcactctctgtggccatctttactgctggccctgcatttacaaatggct 439


>gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (58%)
          Length = 1040

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 66  tggtggttttgattgcaatatctgcttggagtttgcacatgaaccagtggtgactctatg 125
           |||||| ||||||||||| |||||||| || | ||  || || |||||||| ||||| ||
Sbjct: 276 tggtggctttgattgcaacatctgcttagactgtgtgcaagatccagtggttactctgtg 335

                                                  
Query: 126 tggtcacctttactgctggccctgcatctacaagtggct 164
           |||||| || || || ||||||||||| ||||| |||||
Sbjct: 336 tggtcatctctattgttggccctgcatttacaaatggct 374