Miyakogusa Predicted Gene
- Lj4g3v0451030.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0451030.1 Non Chatacterized Hit- tr|I1KLI6|I1KLI6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,94.35,0,ZF_RING_2,Zinc finger, RING-type; RING/U-box,NULL;
seg,NULL; no description,Zinc finger, RING/FYVE/P,CUFF.47252.1
(750 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin... 724 0.0
gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin... 692 0.0
gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1... 74 1e-12
gnl|LJGI|AV417292 74 1e-12
gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1;... 74 1e-12
gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1... 72 5e-12
gnl|LJGI|GO009771 similar to UniRef100_A7PP41 Cluster: Chromosom... 56 3e-07
gnl|LJGI|TC79514 similar to UniRef100_A7PP41 Cluster: Chromosome... 56 3e-07
gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromos... 54 1e-06
gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycl... 54 1e-06
>gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
Medicago truncatula|Rep: Zinc finger, RING-type -
Medicago truncatula (Barrel medic), partial (46%)
Length = 546
Score = 724 bits (365), Expect = 0.0
Identities = 365/365 (100%)
Strand = Plus / Plus
Query: 1 atgtacgtggcggcttccatgcgtaagtccttcaaggactcattgaaactccttgaagct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 atgtacgtggcggcttccatgcgtaagtccttcaaggactcattgaaactccttgaagct 241
Query: 61 gatattcaccatgccaataccctggcctcagattttcctagggaatatgatggagcatgc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 gatattcaccatgccaataccctggcctcagattttcctagggaatatgatggagcatgc 301
Query: 121 cttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtgcagtgg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 cttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtgcagtgg 361
Query: 181 acagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaaggtgtat 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 362 acagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaaggtgtat 421
Query: 241 gtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaattctat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 gtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaattctat 481
Query: 301 gcggtcatttatccctctctgttgcaacttcagaaaggcgttactgatactgaggataga 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 gcggtcatttatccctctctgttgcaacttcagaaaggcgttactgatactgaggataga 541
Query: 361 aagca 365
|||||
Sbjct: 542 aagca 546
>gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
Medicago truncatula|Rep: Zinc finger, RING-type -
Medicago truncatula (Barrel medic), partial (98%)
Length = 1239
Score = 692 bits (349), Expect = 0.0
Identities = 616/705 (87%)
Strand = Plus / Plus
Query: 46 aaactccttgaagctgatattcaccatgccaataccctggcctcagattttcctagggaa 105
||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 197 aaacttcttgaagctgatatccaccatgccaataccctggcctcggattttccgagggaa 256
Query: 106 tatgatggagcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctt 165
|||||||| || |||||||||||||||||||||||||||||||| |||| ||||||||||
Sbjct: 257 tatgatggtgcgtgccttcagatgagaatgtcatacagtccagcagcacgcctgtttctt 316
Query: 166 tttctggtgcagtggacagattgtcaccttgctggggcccttggattgttgagaatccta 225
||| ||||||| |||||||| || | ||||| || || |||||| ||||||||||||||
Sbjct: 317 tttttggtgcaatggacagactgcaatcttgccggagctcttggactgttgagaatccta 376
Query: 226 atttacaaggtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagc 285
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||
Sbjct: 377 atttacaaggtgtatgtggacgggacaactaccatgtctgtccatgaaagaaaagcaagt 436
Query: 286 attagagaattctatgcggtcatttatccctctctgttgcaacttcagaaaggcgttact 345
||||| |||||||||| | |||| ||||||||| | ||||||||||| || || || |||
Sbjct: 437 attagggaattctatgggttcatatatccctctttattgcaacttcaaaagggtgtcact 496
Query: 346 gatactgaggatagaaagcagaaggctgtgtgcatggagaggtatcgcagaagagatgat 405
||||| ||||||| ||| ||||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 497 gatacagaggataaaaaacagaaggctgtttgcatggaaaggtatcgaagaagagatgat 556
Query: 406 gaagagtactggcaatcttctgacttagacattgaaagagaagatgaatgtggaatatgc 465
|| ||| | | || ||||| ||| ||||||||||||||||||| |||||||||||||||
Sbjct: 557 gaggaggatagacagtcttcagacatagacattgaaagagaagaagaatgtggaatatgc 616
Query: 466 atggagacgaatagtaagattgtgttgcccaactgcaaccatgccatgtgcctgaaatgt 525
||||| | ||||||||||||||| ||||| |||||||||| ||||||||||||||||||
Sbjct: 617 atggaaatgaatagtaagattgttttgccagactgcaaccacgccatgtgcctgaaatgt 676
Query: 526 taccgcgaatggcgaacaatatcacagtcatgcccattttgccgtgacaacctgaagcga 585
|||| |||||| |||||| ||||||||||||||| |||||||| |||| || || |
Sbjct: 677 taccatgaatggagaacaagatcacagtcatgccccttttgccgagacagtcttgagagt 736
Query: 586 gtaaactctggtgatctctgggtgtttactgataggagggatgcggtagatatggcaaca 645
|| ||||| |||||||| ||||| || |||||||| ||||||| |||||| |||||||||
Sbjct: 737 gtgaactcaggtgatctgtgggtattaactgatagtagggatgtggtagacatggcaaca 796
Query: 646 gtgacaagggagaaccttagaaggctttttatgtatatagataagctgcctgtgattgtt 705
|||||||||||||| ||||||| ||||| ||||| ||||||||| ||||| |||| ||
Sbjct: 797 gtgacaagggagaatattagaagacttttcatgtacatagataagttgcctctgatcatt 856
Query: 706 ccagaatccctttttgacacatatgactcacacataaggtaagtg 750
||||| ||||||||||| ||||||||||| ||| |||| ||||||
Sbjct: 857 ccagattccctttttgatacatatgactctcacctaagataagtg 901
>gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), partial (74%)
Length = 707
Score = 73.8 bits (37), Expect = 1e-12
Identities = 223/285 (78%)
Strand = Plus / Plus
Query: 55 gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
|||||||||||||| |||| ||||||||||| | ||| ||| |||||| ||||||||
Sbjct: 198 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 257
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
| |||| |||||||||| |||| |||||||||| || | | | ||||| ||| ||
Sbjct: 258 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 317
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaag 234
|||||| |||||| |||||||||| || ||||| ||| ||||||| |||||||| |
Sbjct: 318 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaatttatgtg 377
Query: 235 gtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaa 294
|||| |||||| || || ||||| | | ||||||| ||| ||||||||||| ||
Sbjct: 378 acttatgcaaatgggaatactactatgtcgatttatgaaaggaaatcaagcattagacaa 437
Query: 295 ttctatgcggtcatttatccctctctgttgcaacttcagaaaggc 339
|| ||| || | || | |||| |||| ||||||||||||||||||
Sbjct: 438 ttttattcgattatatttcccgctctattgcaacttcagaaaggc 482
>gnl|LJGI|AV417292
Length = 317
Score = 73.8 bits (37), Expect = 1e-12
Identities = 37/37 (100%)
Strand = Plus / Minus
Query: 714 cctttttgacacatatgactcacacataaggtaagtg 750
|||||||||||||||||||||||||||||||||||||
Sbjct: 317 cctttttgacacatatgactcacacataaggtaagtg 281
>gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), complete
Length = 905
Score = 73.8 bits (37), Expect = 1e-12
Identities = 223/285 (78%)
Strand = Plus / Plus
Query: 55 gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
|||||||||||||| |||| ||||||||||| | ||| ||| |||||| ||||||||
Sbjct: 94 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 153
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
| |||| |||||||||| |||| |||||||||| || | | | ||||| ||| ||
Sbjct: 154 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 213
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaag 234
|||||| |||||| |||||||||| || ||||| ||| ||||||| |||||||| |
Sbjct: 214 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaatttatgtg 273
Query: 235 gtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaa 294
|||| |||||| || || ||||| | | ||||||| ||| ||||||||||| ||
Sbjct: 274 acttatgcaaatgggaatactactatgtcgatttatgaaaggaaatcaagcattagacaa 333
Query: 295 ttctatgcggtcatttatccctctctgttgcaacttcagaaaggc 339
|| ||| || | || | |||| |||| ||||||||||||||||||
Sbjct: 334 ttttattcgattatatttcccgctctattgcaacttcagaaaggc 378
>gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), partial (51%)
Length = 710
Score = 71.9 bits (36), Expect = 5e-12
Identities = 141/176 (80%)
Strand = Plus / Plus
Query: 55 gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
|||||||||||||| |||| ||||||||||| | ||| ||| |||||| ||||||||
Sbjct: 207 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 266
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
| |||| |||||||||| |||| |||||||||| || | | | ||||| ||| ||
Sbjct: 267 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 326
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaattta 230
|||||| |||||| |||||||||| || ||||| ||| ||||||| ||||||||
Sbjct: 327 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaattta 382
Score = 54.0 bits (27), Expect = 1e-06
Identities = 60/71 (84%)
Strand = Plus / Plus
Query: 269 atgaaagaaaagcaagcattagagaattctatgcggtcatttatccctctctgttgcaac 328
||||||| ||| ||||||||||| |||| ||| || | || | |||| |||| |||||||
Sbjct: 554 atgaaaggaaatcaagcattagacaattttattcgattatatttcccgctctattgcaac 613
Query: 329 ttcagaaaggc 339
|||||||||||
Sbjct: 614 ttcagaaaggc 624
>gnl|LJGI|GO009771 similar to UniRef100_A7PP41 Cluster: Chromosome chr8 scaffold_23,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_23, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (40%)
Length = 705
Score = 56.0 bits (28), Expect = 3e-07
Identities = 67/80 (83%)
Strand = Plus / Plus
Query: 445 gaagatgaatgtggaatatgcatggagacgaatagtaagattgtgttgcccaactgcaac 504
||||| |||||||| || || ||||||||||| | ||| ||||||||||||| ||||||
Sbjct: 207 gaagaagaatgtggtatttgtatggagacgaacaagaaggttgtgttgcccaattgcaac 266
Query: 505 catgccatgtgcctgaaatg 524
||| | ||||| |||||||
Sbjct: 267 cattcattgtgcgtgaaatg 286
>gnl|LJGI|TC79514 similar to UniRef100_A7PP41 Cluster: Chromosome chr8 scaffold_23,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_23, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (92%)
Length = 1120
Score = 56.0 bits (28), Expect = 3e-07
Identities = 67/80 (83%)
Strand = Plus / Plus
Query: 445 gaagatgaatgtggaatatgcatggagacgaatagtaagattgtgttgcccaactgcaac 504
||||| |||||||| || || ||||||||||| | ||| ||||||||||||| ||||||
Sbjct: 595 gaagaagaatgtggtatttgtatggagacgaacaagaaggttgtgttgcccaattgcaac 654
Query: 505 catgccatgtgcctgaaatg 524
||| | ||||| |||||||
Sbjct: 655 cattcattgtgcgtgaaatg 674
>gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromosome undetermined
scaffold_1336, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_1336,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (25%)
Length = 445
Score = 54.0 bits (27), Expect = 1e-06
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 704 ttccagaatccctttttgacacatatgactcacacataaggtaagtg 750
||||||| ||||||||||| ||||||||||| ||| |||| ||||||
Sbjct: 429 ttccagattccctttttgatacatatgactctcacctaagataagtg 383
>gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycle control crn
(Crooked neck) protein-like; n=1; Arabidopsis
thaliana|Rep: Cell cycle control crn (Crooked neck)
protein-like - Arabidopsis thaliana (Mouse-ear cress),
partial (6%)
Length = 483
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 46 aaactccttgaagctgatattcaccatgccaataccctg 84
||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 106 aaactgcttgaagttgatatccaccatgccaataccctg 144