Miyakogusa Predicted Gene

Lj4g3v0451030.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0451030.1 Non Chatacterized Hit- tr|I1KLI6|I1KLI6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,94.35,0,ZF_RING_2,Zinc finger, RING-type; RING/U-box,NULL;
seg,NULL; no description,Zinc finger, RING/FYVE/P,CUFF.47252.1
         (750 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin...   724   0.0  
gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin...   692   0.0  
gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1...    74   1e-12
gnl|LJGI|AV417292                                                      74   1e-12
gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1;...    74   1e-12
gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1...    72   5e-12
gnl|LJGI|GO009771 similar to UniRef100_A7PP41 Cluster: Chromosom...    56   3e-07
gnl|LJGI|TC79514 similar to UniRef100_A7PP41 Cluster: Chromosome...    56   3e-07
gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromos...    54   1e-06
gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycl...    54   1e-06

>gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
           Medicago truncatula|Rep: Zinc finger, RING-type -
           Medicago truncatula (Barrel medic), partial (46%)
          Length = 546

 Score =  724 bits (365), Expect = 0.0
 Identities = 365/365 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtacgtggcggcttccatgcgtaagtccttcaaggactcattgaaactccttgaagct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182 atgtacgtggcggcttccatgcgtaagtccttcaaggactcattgaaactccttgaagct 241

                                                                       
Query: 61  gatattcaccatgccaataccctggcctcagattttcctagggaatatgatggagcatgc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 gatattcaccatgccaataccctggcctcagattttcctagggaatatgatggagcatgc 301

                                                                       
Query: 121 cttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtgcagtgg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 cttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtgcagtgg 361

                                                                       
Query: 181 acagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaaggtgtat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 362 acagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaaggtgtat 421

                                                                       
Query: 241 gtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaattctat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 gtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaattctat 481

                                                                       
Query: 301 gcggtcatttatccctctctgttgcaacttcagaaaggcgttactgatactgaggataga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 gcggtcatttatccctctctgttgcaacttcagaaaggcgttactgatactgaggataga 541

                
Query: 361 aagca 365
           |||||
Sbjct: 542 aagca 546


>gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
           Medicago truncatula|Rep: Zinc finger, RING-type -
           Medicago truncatula (Barrel medic), partial (98%)
          Length = 1239

 Score =  692 bits (349), Expect = 0.0
 Identities = 616/705 (87%)
 Strand = Plus / Plus

                                                                       
Query: 46  aaactccttgaagctgatattcaccatgccaataccctggcctcagattttcctagggaa 105
           ||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 197 aaacttcttgaagctgatatccaccatgccaataccctggcctcggattttccgagggaa 256

                                                                       
Query: 106 tatgatggagcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctt 165
           |||||||| || |||||||||||||||||||||||||||||||| |||| ||||||||||
Sbjct: 257 tatgatggtgcgtgccttcagatgagaatgtcatacagtccagcagcacgcctgtttctt 316

                                                                       
Query: 166 tttctggtgcagtggacagattgtcaccttgctggggcccttggattgttgagaatccta 225
           ||| ||||||| |||||||| ||  | ||||| || || |||||| ||||||||||||||
Sbjct: 317 tttttggtgcaatggacagactgcaatcttgccggagctcttggactgttgagaatccta 376

                                                                       
Query: 226 atttacaaggtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagc 285
           |||||||||||||||||||| |||||||| |||||||||   ||||||||||||||||| 
Sbjct: 377 atttacaaggtgtatgtggacgggacaactaccatgtctgtccatgaaagaaaagcaagt 436

                                                                       
Query: 286 attagagaattctatgcggtcatttatccctctctgttgcaacttcagaaaggcgttact 345
           ||||| |||||||||| | |||| ||||||||| | ||||||||||| || || || |||
Sbjct: 437 attagggaattctatgggttcatatatccctctttattgcaacttcaaaagggtgtcact 496

                                                                       
Query: 346 gatactgaggatagaaagcagaaggctgtgtgcatggagaggtatcgcagaagagatgat 405
           ||||| ||||||| ||| ||||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 497 gatacagaggataaaaaacagaaggctgtttgcatggaaaggtatcgaagaagagatgat 556

                                                                       
Query: 406 gaagagtactggcaatcttctgacttagacattgaaagagaagatgaatgtggaatatgc 465
           || ||| |  | || ||||| ||| ||||||||||||||||||| |||||||||||||||
Sbjct: 557 gaggaggatagacagtcttcagacatagacattgaaagagaagaagaatgtggaatatgc 616

                                                                       
Query: 466 atggagacgaatagtaagattgtgttgcccaactgcaaccatgccatgtgcctgaaatgt 525
           ||||| | ||||||||||||||| |||||  |||||||||| ||||||||||||||||||
Sbjct: 617 atggaaatgaatagtaagattgttttgccagactgcaaccacgccatgtgcctgaaatgt 676

                                                                       
Query: 526 taccgcgaatggcgaacaatatcacagtcatgcccattttgccgtgacaacctgaagcga 585
           ||||  |||||| |||||| ||||||||||||||| |||||||| ||||  ||  || | 
Sbjct: 677 taccatgaatggagaacaagatcacagtcatgccccttttgccgagacagtcttgagagt 736

                                                                       
Query: 586 gtaaactctggtgatctctgggtgtttactgataggagggatgcggtagatatggcaaca 645
           || ||||| |||||||| ||||| || |||||||| ||||||| |||||| |||||||||
Sbjct: 737 gtgaactcaggtgatctgtgggtattaactgatagtagggatgtggtagacatggcaaca 796

                                                                       
Query: 646 gtgacaagggagaaccttagaaggctttttatgtatatagataagctgcctgtgattgtt 705
           ||||||||||||||  ||||||| ||||| ||||| ||||||||| ||||| ||||  ||
Sbjct: 797 gtgacaagggagaatattagaagacttttcatgtacatagataagttgcctctgatcatt 856

                                                        
Query: 706 ccagaatccctttttgacacatatgactcacacataaggtaagtg 750
           ||||| ||||||||||| ||||||||||| ||| |||| ||||||
Sbjct: 857 ccagattccctttttgatacatatgactctcacctaagataagtg 901


>gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
           truncatula|Rep: MTD2 - Medicago truncatula (Barrel
           medic), partial (74%)
          Length = 707

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 223/285 (78%)
 Strand = Plus / Plus

                                                                       
Query: 55  gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
           ||||||||||||||  |||| ||||||||||| |  |||  ||| |||||| ||||||||
Sbjct: 198 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 257

                                                                       
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
           | |||| ||||||||||  |||| ||||||||||  || | | | |||||   ||| || 
Sbjct: 258 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 317

                                                                       
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaag 234
           |||||| ||||||   |||||||||| || ||||| ||| ||||||| ||||||||   |
Sbjct: 318 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaatttatgtg 377

                                                                       
Query: 235 gtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaa 294
              ||||   ||||||  || || ||||| | | ||||||| ||| ||||||||||| ||
Sbjct: 378 acttatgcaaatgggaatactactatgtcgatttatgaaaggaaatcaagcattagacaa 437

                                                        
Query: 295 ttctatgcggtcatttatccctctctgttgcaacttcagaaaggc 339
           || ||| || | || | |||| |||| ||||||||||||||||||
Sbjct: 438 ttttattcgattatatttcccgctctattgcaacttcagaaaggc 482


>gnl|LJGI|AV417292 
          Length = 317

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 714 cctttttgacacatatgactcacacataaggtaagtg 750
           |||||||||||||||||||||||||||||||||||||
Sbjct: 317 cctttttgacacatatgactcacacataaggtaagtg 281


>gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
           truncatula|Rep: MTD2 - Medicago truncatula (Barrel
           medic), complete
          Length = 905

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 223/285 (78%)
 Strand = Plus / Plus

                                                                       
Query: 55  gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
           ||||||||||||||  |||| ||||||||||| |  |||  ||| |||||| ||||||||
Sbjct: 94  gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 153

                                                                       
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
           | |||| ||||||||||  |||| ||||||||||  || | | | |||||   ||| || 
Sbjct: 154 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 213

                                                                       
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaatttacaag 234
           |||||| ||||||   |||||||||| || ||||| ||| ||||||| ||||||||   |
Sbjct: 214 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaatttatgtg 273

                                                                       
Query: 235 gtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagcattagagaa 294
              ||||   ||||||  || || ||||| | | ||||||| ||| ||||||||||| ||
Sbjct: 274 acttatgcaaatgggaatactactatgtcgatttatgaaaggaaatcaagcattagacaa 333

                                                        
Query: 295 ttctatgcggtcatttatccctctctgttgcaacttcagaaaggc 339
           || ||| || | || | |||| |||| ||||||||||||||||||
Sbjct: 334 ttttattcgattatatttcccgctctattgcaacttcagaaaggc 378


>gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
           truncatula|Rep: MTD2 - Medicago truncatula (Barrel
           medic), partial (51%)
          Length = 710

 Score = 71.9 bits (36), Expect = 5e-12
 Identities = 141/176 (80%)
 Strand = Plus / Plus

                                                                       
Query: 55  gaagctgatattcaccatgccaataccctggcctcagattttcctagggaatatgatgga 114
           ||||||||||||||  |||| ||||||||||| |  |||  ||| |||||| ||||||||
Sbjct: 207 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 266

                                                                       
Query: 115 gcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctttttctggtg 174
           | |||| ||||||||||  |||| ||||||||||  || | | | |||||   ||| || 
Sbjct: 267 ggatgctttcagatgaggctgtcttacagtccagtagcccccatttttctccctcttgtt 326

                                                                   
Query: 175 cagtggacagattgtcaccttgctggggcccttggattgttgagaatcctaattta 230
           |||||| ||||||   |||||||||| || ||||| ||| ||||||| ||||||||
Sbjct: 327 cagtgggcagattacaaccttgctggtgctcttggtttgctgagaattctaattta 382



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 atgaaagaaaagcaagcattagagaattctatgcggtcatttatccctctctgttgcaac 328
           ||||||| ||| ||||||||||| |||| ||| || | || | |||| |||| |||||||
Sbjct: 554 atgaaaggaaatcaagcattagacaattttattcgattatatttcccgctctattgcaac 613

                      
Query: 329 ttcagaaaggc 339
           |||||||||||
Sbjct: 614 ttcagaaaggc 624


>gnl|LJGI|GO009771 similar to UniRef100_A7PP41 Cluster: Chromosome chr8 scaffold_23,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_23, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (40%)
          Length = 705

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 445 gaagatgaatgtggaatatgcatggagacgaatagtaagattgtgttgcccaactgcaac 504
           ||||| |||||||| || || ||||||||||| |  ||| ||||||||||||| ||||||
Sbjct: 207 gaagaagaatgtggtatttgtatggagacgaacaagaaggttgtgttgcccaattgcaac 266

                               
Query: 505 catgccatgtgcctgaaatg 524
           ||| |  ||||| |||||||
Sbjct: 267 cattcattgtgcgtgaaatg 286


>gnl|LJGI|TC79514 similar to UniRef100_A7PP41 Cluster: Chromosome chr8 scaffold_23,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_23, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (92%)
          Length = 1120

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 445 gaagatgaatgtggaatatgcatggagacgaatagtaagattgtgttgcccaactgcaac 504
           ||||| |||||||| || || ||||||||||| |  ||| ||||||||||||| ||||||
Sbjct: 595 gaagaagaatgtggtatttgtatggagacgaacaagaaggttgtgttgcccaattgcaac 654

                               
Query: 505 catgccatgtgcctgaaatg 524
           ||| |  ||||| |||||||
Sbjct: 655 cattcattgtgcgtgaaatg 674


>gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromosome undetermined
           scaffold_1336, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_1336,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (25%)
          Length = 445

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 704 ttccagaatccctttttgacacatatgactcacacataaggtaagtg 750
           ||||||| ||||||||||| ||||||||||| ||| |||| ||||||
Sbjct: 429 ttccagattccctttttgatacatatgactctcacctaagataagtg 383


>gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycle control crn
           (Crooked neck) protein-like; n=1; Arabidopsis
           thaliana|Rep: Cell cycle control crn (Crooked neck)
           protein-like - Arabidopsis thaliana (Mouse-ear cress),
           partial (6%)
          Length = 483

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 46  aaactccttgaagctgatattcaccatgccaataccctg 84
           ||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 106 aaactgcttgaagttgatatccaccatgccaataccctg 144