Miyakogusa Predicted Gene

Lj4g3v0447890.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0447890.1 Non Chatacterized Hit- tr|I1KLE3|I1KLE3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,85.82,0,no
description,NULL; seg,NULL; FAD/NAD(P)-binding domain,NULL;
FADPNR,FAD-dependent pyridine nucleot,CUFF.47217.1
         (1650 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72913 similar to UniRef100_A7NYD9 Cluster: Chromosome...    70   5e-11

>gnl|LJGI|TC72913 similar to UniRef100_A7NYD9 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (52%)
          Length = 1149

 Score = 69.9 bits (35), Expect = 5e-11
 Identities = 110/135 (81%)
 Strand = Plus / Plus

                                                                       
Query: 862 cctactggagtggaattcagtggtgaattgagtgatttcatcatgaaagatgttcatgag 921
           ||||| ||||| || |||||||||||| |||||||||| ||||||| |||||| | | ||
Sbjct: 2   cctaccggagttgagttcagtggtgaactgagtgattttatcatgagagatgtccgtcag 61

                                                                       
Query: 922 cgatacactcatgttaaagattacattcacgtcacgctcattgaggcaaatgagatactg 981
            ||||  ||||||| || || || || || || ||  | |||||||| ||||||||| ||
Sbjct: 62  agatattctcatgtgaaggactatatccatgttactttaattgaggccaatgagatattg 121

                          
Query: 982 tcatcctttgatgtt 996
           || ||||||||||||
Sbjct: 122 tcttcctttgatgtt 136