Miyakogusa Predicted Gene

Lj4g3v0445590.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0445590.1 Non Chatacterized Hit- tr|I1KQQ2|I1KQQ2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,71.95,0,FAMILY NOT
NAMED,NULL; BBE,Berberine/berberine-like,gene.g52320.t1.1
         (735 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked...    84   1e-15

>gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked oxidase, N-terminal;
            n=1; Medicago truncatula|Rep: FAD linked oxidase,
            N-terminal - Medicago truncatula (Barrel medic), partial
            (71%)
          Length = 1252

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                        
Query: 488  tttcaaggttattctatgaatttatggccccatatgtttcaaactctccgagggaggtat 547
            ||||||||| ||| ||||| || ||| |||| | ||||||||| || || |||||||  |
Sbjct: 1011 tttcaaggtcattttatgagttcatgaccccgtttgtttcaaaatccccaagggaggcgt 1070

                                                                  
Query: 548  tcctcaattacagggatcttgatatcggagtcaatcatcaaagcagtgcaacaa 601
            ||||||||||||| ||||||||||| |||| |||||||| ||| | ||||||||
Sbjct: 1071 tcctcaattacagagatcttgatattggagccaatcatccaagtaatgcaacaa 1124



 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                       
Query: 316 atgattaaaattgagtgtgtgcggatggaatggaacccttatggtgggaagatggacaat 375
           |||||||||  |||| ||||  ||||| ||||||| ||||||||||| |||||||| || 
Sbjct: 845 atgattaaaggtgagagtgtatggatgcaatggaatccttatggtggaaagatggagaag 904

                                                                       
Query: 376 atttcagcattagaaacaccattccctcatagaggtgggaacttgttcttgattgagtac 435
           |||||| |||| ||||| || || ||||| || |  |||||||| ||||||||| |||||
Sbjct: 905 atttcaccatttgaaaccccctttcctcacagggcagggaacttattcttgattcagtac 964

            
Query: 436 t 436
           |
Sbjct: 965 t 965