Miyakogusa Predicted Gene
- Lj4g3v0435290.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0435290.1 Non Chatacterized Hit- tr|I1HIG9|I1HIG9_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,29.05,0.0000000000004,seg,NULL; PLAC8,Uncharacterised protein
family Cys-rich; A_thal_Cys_rich: uncharacterized Cys-rich
d,CUFF.47128.1
(906 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AW163889 similar to UniRef100_A7R078 Cluster: Chromosom... 525 e-148
gnl|LJGI|FS323606 similar to UniRef100_Q2HTU7 Cluster: Uncharact... 274 9e-73
gnl|LJGI|TC65409 similar to UniRef100_A7R078 Cluster: Chromosome... 137 1e-31
>gnl|LJGI|AW163889 similar to UniRef100_A7R078 Cluster: Chromosome undetermined
scaffold_298, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_298,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (23%)
Length = 265
Score = 525 bits (265), Expect = e-148
Identities = 265/265 (100%)
Strand = Plus / Plus
Query: 202 ggattggatttggaggtggaagagaaggagaggttgctggactttgacatgctttgttcc 261
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ggattggatttggaggtggaagagaaggagaggttgctggactttgacatgctttgttcc 60
Query: 262 actgtggctttgagagctgcacaagggaaatgggggaagctgcagggggaggaacatgaa 321
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 actgtggctttgagagctgcacaagggaaatgggggaagctgcagggggaggaacatgaa 120
Query: 322 gaacacaatgaaggtggggtatttggtggtgtgttgagaatgtgggagggtgatctcttt 381
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gaacacaatgaaggtggggtatttggtggtgtgttgagaatgtgggagggtgatctcttt 180
Query: 382 gattgctttgatcatcgtcgcatagctcttgaatccatattctgtccttgctaccgattt 441
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gattgctttgatcatcgtcgcatagctcttgaatccatattctgtccttgctaccgattt 240
Query: 442 gggaagaacatgaagagagctggtt 466
|||||||||||||||||||||||||
Sbjct: 241 gggaagaacatgaagagagctggtt 265
>gnl|LJGI|FS323606 similar to UniRef100_Q2HTU7 Cluster: Uncharacterized Cys-rich
domain; n=1; Medicago truncatula|Rep: Uncharacterized
Cys-rich domain - Medicago truncatula (Barrel medic),
partial (80%)
Length = 824
Score = 274 bits (138), Expect = 9e-73
Identities = 360/434 (82%)
Strand = Plus / Plus
Query: 361 atgtgggagggtgatctctttgattgctttgatcatcgtcgcatagctcttgaatccata 420
|||||||||||||| | ||||||| || ||| |||| ||||| ||||||||||| |
Sbjct: 361 atgtgggagggtgaattacttgattgtttcgatgatcgccgcatcgctcttgaatctgca 420
Query: 421 ttctgtccttgctaccgatttgggaagaacatgaagagagctggttttggttcttgctac 480
| ||||| |||||||| |||||||||||||||||| |||||||||||||||||||||
Sbjct: 421 tgttgtccatgctaccggtttgggaagaacatgaagcgagctggttttggttcttgcttt 480
Query: 481 attcaggcagcagtttattttctccttgcaattggttccttgattagcttcattgcattt 540
|||||||||| ||| |||||||| ||||| |||||| |||| ||| ||| ||||| |||
Sbjct: 481 attcaggcagtagtatattttcttcttgctattggtgcctttcttaactttattgctttt 540
Query: 541 ggtgtcacgagacgcaactgctttctctacctggcactgaccttcattgtttctattgga 600
|||||||| || ||| ||| || ||||| | | | ||||||| || || | |||
Sbjct: 541 acggtcacgaggcgtcactacttcctataccttggaattgccttcatcattactgtggga 600
Query: 601 gcatatttaggattctacaggactcgtataagaaagaaattcaacatcaagggtagtgat 660
||||||||||| ||||| | |||||| | |||||||||||||||||||||||||||||
Sbjct: 601 gcatatttaggtttctatcgaactcgtgtgcgaaagaaattcaacatcaagggtagtgat 660
Query: 661 agttccttggatgattgtgtctaccattttgcctgtccttgttgcacattatgtcaggaa 720
||||| ||||| ||||| || |||||||| |||||||||||| ||||||||||||||
Sbjct: 661 agttcgttggacgattgcgtttaccatttcatctgtccttgttgtacattatgtcaggag 720
Query: 721 tccagaacattggaaatgaacaatgttcaagatggcacttggcatggtcgtggtgacaca 780
|| |||||| | || |||||||| |||||||| ||||| ||||||||||| ||||||||
Sbjct: 721 tcaagaacacttgagatgaacaacgttcaagacggcacctggcatggtcggggtgacacg 780
Query: 781 atatgcataggtgg 794
||||| ||||||||
Sbjct: 781 atatgtataggtgg 794
>gnl|LJGI|TC65409 similar to UniRef100_A7R078 Cluster: Chromosome undetermined
scaffold_298, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_298,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (25%)
Length = 671
Score = 137 bits (69), Expect = 1e-31
Identities = 126/145 (86%)
Strand = Plus / Plus
Query: 650 agggtagtgatagttccttggatgattgtgtctaccattttgcctgtccttgttgcacat 709
|||||||||||||||| ||||| ||||| || |||||||| |||||||||||| ||||
Sbjct: 54 agggtagtgatagttcgttggacgattgcgtttaccatttcatctgtccttgttgtacat 113
Query: 710 tatgtcaggaatccagaacattggaaatgaacaatgttcaagatggcacttggcatggtc 769
|||||||||| || |||||| | || |||||||| |||||||| ||||| ||||||||||
Sbjct: 114 tatgtcaggagtcaagaacacttgagatgaacaacgttcaagacggcacctggcatggtc 173
Query: 770 gtggtgacacaatatgcataggtgg 794
| |||||||| ||||| ||||||||
Sbjct: 174 ggggtgacacgatatgtataggtgg 198