Miyakogusa Predicted Gene

Lj4g3v0335870.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0335870.1 Non Chatacterized Hit- tr|I1KR76|I1KR76_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.43510
PE,85,0,alpha/beta-Hydrolases,NULL; UNCHARACTERIZED,NULL; no
description,NULL; coiled-coil,NULL; DUF676,Doma,CUFF.46858.1
         (1143 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69173 similar to UniRef100_A7Q6S3 Cluster: Chromosome...   281   5e-75

>gnl|LJGI|TC69173 similar to UniRef100_A7Q6S3 Cluster: Chromosome chr12 scaffold_57,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr12 scaffold_57, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (21%)
          Length = 695

 Score =  281 bits (142), Expect = 5e-75
 Identities = 328/390 (84%)
 Strand = Plus / Plus

                                                                        
Query: 730  atatctggtccacacttgggttatatgtatagttcgaactctctattcaactcggggctg 789
            ||||| ||||| ||||||||||||||||| ||||| |||||| ||||||| || ||  ||
Sbjct: 1    atatccggtccgcacttgggttatatgtacagttcaaactctatattcaattcaggattg 60

                                                                        
Query: 790  tggttattgaagaagttcaagggcacacaatgcattcatcaactgaccttcacggatgac 849
            ||| | ||||| ||  ||||||||||||||||||| |||||||| || ||||| ||||| 
Sbjct: 61   tggctcttgaaaaaaatcaagggcacacaatgcatccatcaactaactttcacagatgat 120

                                                                        
Query: 850  cctgatcttgagaatactttcatctacaatctttccaaggagaagacactggaaaacttc 909
            |  ||||||||||| || ||||||||||||||||| |||  ||||||||||| |||||||
Sbjct: 121  cacgatcttgagaacaccttcatctacaatctttcgaagatgaagacactggcaaacttc 180

                                                                        
Query: 910  aggaacgtgattctcttgtcttcacctcaggatggttatgttccataccattctgcaaga 969
            | ||| |||||||| || || || |||||||||||||||||||| |||||||| || |||
Sbjct: 181  aagaatgtgattcttttatcctctcctcaggatggttatgttccgtaccattcagccaga 240

                                                                        
Query: 970  attgaaacgtgtccagcggcttctttagatttctctaaaagagggaaaatcttcttggag 1029
            || |||  ||||||||| ||||||| |||||| ||||||  ||||||| | ||| |||| 
Sbjct: 241  atagaactgtgtccagcagcttcttcagatttttctaaacaagggaaagtgttcctggat 300

                                                                        
Query: 1030 atgctgaataattgcttggaccaattccgaacttgctctgaccatcgtgtgatcatgcgc 1089
            ||| | ||||||||| |||||||||| || |||  |||||| ||||||||| || |||||
Sbjct: 301  atgttaaataattgcctggaccaattgcggactcactctgatcatcgtgtggtcttgcgc 360

                                          
Query: 1090 tgtgacatcaacttcaacacctcttcctat 1119
            |||||||| |||||| | ||||| ||||||
Sbjct: 361  tgtgacattaacttcgaaacctcctcctat 390