Miyakogusa Predicted Gene

Lj4g3v0189780.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0189780.1 tr|A9RYS0|A9RYS0_PHYPA Predicted protein
OS=Physcomitrella patens subsp. patens
GN=PHYPADRAFT_179489,52.63,4e-17,coiled-coil,NULL,CUFF.46619.1
         (249 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69602                                                      494   e-139
gnl|LJGI|BW600093                                                     246   5e-65

>gnl|LJGI|TC69602 
          Length = 554

 Score =  494 bits (249), Expect = e-139
 Identities = 249/249 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtactgagcgcgacggcgatcggcgccttattgggtttgggcacccagatgtactcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32  atggtactgagcgcgacggcgatcggcgccttattgggtttgggcacccagatgtactcc 91

                                                                       
Query: 61  aacgccctccgcaaactgccctacatgcgccatccatgggagcacgttttgggaatggga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92  aacgccctccgcaaactgccctacatgcgccatccatgggagcacgttttgggaatggga 151

                                                                       
Query: 121 attggcgtggtgttcgttaaccagcttctgaaatgggaggctcaggttgaacgtgatctc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 152 attggcgtggtgttcgttaaccagcttctgaaatgggaggctcaggttgaacgtgatctc 211

                                                                       
Query: 181 gatgtcatgctcgagagggccaaagcagctaacgaaagacgttacatagatgcagatgaa 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 212 gatgtcatgctcgagagggccaaagcagctaacgaaagacgttacatagatgcagatgaa 271

                    
Query: 241 gattagtgt 249
           |||||||||
Sbjct: 272 gattagtgt 280


>gnl|LJGI|BW600093 
          Length = 483

 Score =  246 bits (124), Expect = 5e-65
 Identities = 225/252 (89%), Gaps = 5/252 (1%)
 Strand = Plus / Plus

                                                                       
Query: 3   ggtactgagcgcgacggcgatcggcgccttattgggtttgggcacccagatgtactccaa 62
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 50  ggtactgagcgcgacggcgatcggcgccttattgggtttgggcatccagatgtactccag 109

                                                                       
Query: 63  cgccctccgcaaactgccctacatgcgcca-tccatgggagca-cgttttgggaatggga 120
           ||| |||||||||||||||||  ||||||| ||| |||||||| |||  |||||||||||
Sbjct: 110 cgctctccgcaaactgccctaggtgcgccactccttgggagcagcgtactgggaatggga 169

                                                                       
Query: 121 attggcgtggtgttcgttaaccagcttctgaaatgggaggctcaggttgaacgtgatctc 180
           ||||||||||||||| |||| | |||||| || ||||||||||||||||||||| |||||
Sbjct: 170 attggcgtggtgttccttaagctgcttcttaagtgggaggctcaggttgaacgttatctc 229

                                                                       
Query: 181 gatgtcatg-ctcgagagggc-caaagcag-ctaacgaaagacgttacatagatgcagat 237
            ||||| || |||  |||||| | |||||| |||||||| |||||||| || ||||||||
Sbjct: 230 catgtcctgcctcttgagggctctaagcagtctaacgaatgacgttacttacatgcagat 289

                       
Query: 238 gaagattagtgt 249
           ||||||||||||
Sbjct: 290 gaagattagtgt 301