Miyakogusa Predicted Gene

Lj4g3v0189760.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0189760.1 Non Chatacterized Hit- tr|I1GU67|I1GU67_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,39.84,3e-18,seg,NULL; Ring finger,Zinc finger, RING-type;
zf-C3HC4_3,NULL; coiled-coil,NULL; no description,Zinc,CUFF.46617.1
         (2550 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79563 similar to UniRef100_A7PHV4 Cluster: Chromosome...    66   1e-09

>gnl|LJGI|TC79563 similar to UniRef100_A7PHV4 Cluster: Chromosome chr13 scaffold_17,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr13 scaffold_17, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (11%)
          Length = 505

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                             
Query: 2398 tacagatgtgggcacatgtgtgcatgtttcaaatgtgccaatgagttgc 2446
            ||||||||||||||| ||||| |||||| ||||||||| ||||||||||
Sbjct: 186  tacagatgtgggcacttgtgtacatgttccaaatgtgctaatgagttgc 234