Miyakogusa Predicted Gene

Lj4g3v0166190.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0166190.1 Non Chatacterized Hit- tr|I1K3A6|I1K3A6_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,72.69,0,OLIGOPEPTIDE
TRANSPORTER-RELATED,NULL; OLIGOPEPTIDE
TRANSPORTER-RELATED,Proton-dependent
oligopeptid,NODE_73218_length_1226_cov_17.867863.path1.1
         (676 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide ...    64   1e-09

>gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
           Vicia faba|Rep: Peptide transporter 1 - Vicia faba
           (Broad bean), partial (33%)
          Length = 745

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 136 gttccaattgcaagaaaattcaccggcaatgtaaagggcttctcagaattgcaaaggatg 195
           ||||| |||||||| ||||| |||||||| | || |||||| ||||| |||||||| |||
Sbjct: 72  gttcccattgcaaggaaatttaccggcaagggaaggggcttttcagagttgcaaagaatg 131

                   
Query: 196 ggaattgg 203
           ||||||||
Sbjct: 132 ggaattgg 139



 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 556 catctagattactttttctggatgctggctggtctcagtttcttaaacatgttggt 611
           ||||||||||||||||||||| |  | ||||| || || |||||||||||||||||
Sbjct: 492 catctagattactttttctggcttttagctggacttagcttcttaaacatgttggt 547