Miyakogusa Predicted Gene
- Lj4g3v0166170.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0166170.1 Non Chatacterized Hit- tr|I1K3A6|I1K3A6_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,72.22,0,OLIGOPEPTIDE
TRANSPORTER-RELATED,NULL; OLIGOPEPTIDE
TRANSPORTER-RELATED,Proton-dependent
oligopeptid,NODE_70054_length_957_cov_48.205853.path1.1
(676 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS360102 similar to UniRef100_Q7XAC3 Cluster: Peptide t... 90 2e-17
gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide ... 78 8e-14
gnl|LJGI|BW597725 similar to UniRef100_Q7XAC3 Cluster: Peptide t... 68 8e-11
>gnl|LJGI|FS360102 similar to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
Vicia faba|Rep: Peptide transporter 1 - Vicia faba
(Broad bean), partial (26%)
Length = 665
Score = 89.7 bits (45), Expect = 2e-17
Identities = 135/165 (81%)
Strand = Plus / Minus
Query: 453 ttcactggggaattacctgagcactttgattcttattattgttgctttcctcacaacaga 512
|||| ||||||||||| ||||| |||| ||||||| ||| || ||| | |||| ||| |
Sbjct: 392 ttcattggggaattacttgagctctttcattcttactatagtaacttacttcactacaca 333
Query: 513 agatggaagttctggatggataacagataatttgaatgagggtcatcttgactacttctt 572
|| ||||| | |||| ||||| ||||||| ||||| | ||||||||||| ||||| ||
Sbjct: 332 aggtggaaatcctgggtggattccagataacttgaacaaaggtcatcttgattacttttt 273
Query: 573 ttggctgctagctggactcagtttcttaaacatgttggtgtacat 617
||||| |||||||||| || |||||||| ||||||||||||||
Sbjct: 272 ctggcttttagctggacttagcttcttaaatatgttggtgtacat 228
>gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
Vicia faba|Rep: Peptide transporter 1 - Vicia faba
(Broad bean), partial (33%)
Length = 745
Score = 77.8 bits (39), Expect = 8e-14
Identities = 225/287 (78%)
Strand = Plus / Plus
Query: 331 cctcaatatttcttgcttggtgctgcacaggtattcacctttgttgggcagcatgaattt 390
||||| |||||||| | || |||||| ||||||| || || || ||||||| ||| ||
Sbjct: 267 cctcagtatttcttattgggggctgcagaggtatttacattcgtggggcagcttgagttc 326
Query: 391 ttctatgagcaagcaccaacctccatgcgtagtttctgcagcgcattggcacttctaaca 450
|||||||| ||| ||||| | ||||| ||||| ||||| || ||| ||||||| ||
Sbjct: 327 ttctatgaccaatcaccagatgctatgcgcagtttatgcagtgctttgtcacttctcacc 386
Query: 451 aattcactggggaattacctgagcactttgattcttattattgttgctttcctcacaaca 510
| |||| ||||||||||| ||||| |||| ||||| | | || ||| | |||| |||
Sbjct: 387 acttcattggggaattacttgagctctttcattctcaccctagtaacttacgtcactaca 446
Query: 511 gaagatggaagttctggatggataacagataatttgaatgagggtcatcttgactacttc 570
|| ||||| | |||| ||||| ||||||| ||||| | |||||||| || |||||
Sbjct: 447 cgaggtggaaatcctgggtggattccagataacttgaacaaaggtcatctagattacttt 506
Query: 571 ttttggctgctagctggactcagtttcttaaacatgttggtgtacat 617
|| ||||| |||||||||| || |||||||||||||||||||||||
Sbjct: 507 ttctggcttttagctggacttagcttcttaaacatgttggtgtacat 553
>gnl|LJGI|BW597725 similar to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
Vicia faba|Rep: Peptide transporter 1 - Vicia faba
(Broad bean), partial (17%)
Length = 389
Score = 67.9 bits (34), Expect = 8e-11
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 526 ggatggataacagataatttgaatgagggtcatcttgactacttcttttggctgctagct 585
|||||||| ||||||| ||||| | ||||||||||| ||||| || ||||| |||||
Sbjct: 182 ggatggattccagataacttgaacaatggtcatcttgattactttttctggcttttagct 241
Query: 586 ggactcagtttcttaaacatgttggtgtacattg 619
||||| || |||||||| ||||||||||| ||||
Sbjct: 242 ggacttagcttcttaaatatgttggtgtatattg 275