Miyakogusa Predicted Gene

Lj4g3v0166170.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0166170.1 Non Chatacterized Hit- tr|I1K3A6|I1K3A6_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,72.22,0,OLIGOPEPTIDE
TRANSPORTER-RELATED,NULL; OLIGOPEPTIDE
TRANSPORTER-RELATED,Proton-dependent
oligopeptid,NODE_70054_length_957_cov_48.205853.path1.1
         (676 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS360102 similar to UniRef100_Q7XAC3 Cluster: Peptide t...    90   2e-17
gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide ...    78   8e-14
gnl|LJGI|BW597725 similar to UniRef100_Q7XAC3 Cluster: Peptide t...    68   8e-11

>gnl|LJGI|FS360102 similar to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
           Vicia faba|Rep: Peptide transporter 1 - Vicia faba
           (Broad bean), partial (26%)
          Length = 665

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 135/165 (81%)
 Strand = Plus / Minus

                                                                       
Query: 453 ttcactggggaattacctgagcactttgattcttattattgttgctttcctcacaacaga 512
           |||| ||||||||||| ||||| |||| ||||||| ||| ||  ||| | |||| ||| |
Sbjct: 392 ttcattggggaattacttgagctctttcattcttactatagtaacttacttcactacaca 333

                                                                       
Query: 513 agatggaagttctggatggataacagataatttgaatgagggtcatcttgactacttctt 572
           || ||||| | |||| |||||  ||||||| |||||  | ||||||||||| ||||| ||
Sbjct: 332 aggtggaaatcctgggtggattccagataacttgaacaaaggtcatcttgattacttttt 273

                                                        
Query: 573 ttggctgctagctggactcagtttcttaaacatgttggtgtacat 617
            |||||  |||||||||| || |||||||| ||||||||||||||
Sbjct: 272 ctggcttttagctggacttagcttcttaaatatgttggtgtacat 228


>gnl|LJGI|TC66812 homologue to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
           Vicia faba|Rep: Peptide transporter 1 - Vicia faba
           (Broad bean), partial (33%)
          Length = 745

 Score = 77.8 bits (39), Expect = 8e-14
 Identities = 225/287 (78%)
 Strand = Plus / Plus

                                                                       
Query: 331 cctcaatatttcttgcttggtgctgcacaggtattcacctttgttgggcagcatgaattt 390
           ||||| ||||||||  | || |||||| ||||||| || || || ||||||| ||| || 
Sbjct: 267 cctcagtatttcttattgggggctgcagaggtatttacattcgtggggcagcttgagttc 326

                                                                       
Query: 391 ttctatgagcaagcaccaacctccatgcgtagtttctgcagcgcattggcacttctaaca 450
           |||||||| ||| |||||    | ||||| ||||| ||||| || ||| ||||||| || 
Sbjct: 327 ttctatgaccaatcaccagatgctatgcgcagtttatgcagtgctttgtcacttctcacc 386

                                                                       
Query: 451 aattcactggggaattacctgagcactttgattcttattattgttgctttcctcacaaca 510
           | |||| ||||||||||| ||||| |||| ||||| |   | ||  ||| | |||| |||
Sbjct: 387 acttcattggggaattacttgagctctttcattctcaccctagtaacttacgtcactaca 446

                                                                       
Query: 511 gaagatggaagttctggatggataacagataatttgaatgagggtcatcttgactacttc 570
             || ||||| | |||| |||||  ||||||| |||||  | |||||||| || ||||| 
Sbjct: 447 cgaggtggaaatcctgggtggattccagataacttgaacaaaggtcatctagattacttt 506

                                                          
Query: 571 ttttggctgctagctggactcagtttcttaaacatgttggtgtacat 617
           || |||||  |||||||||| || |||||||||||||||||||||||
Sbjct: 507 ttctggcttttagctggacttagcttcttaaacatgttggtgtacat 553


>gnl|LJGI|BW597725 similar to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
           Vicia faba|Rep: Peptide transporter 1 - Vicia faba
           (Broad bean), partial (17%)
          Length = 389

 Score = 67.9 bits (34), Expect = 8e-11
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 526 ggatggataacagataatttgaatgagggtcatcttgactacttcttttggctgctagct 585
           ||||||||  ||||||| |||||  | ||||||||||| ||||| || |||||  |||||
Sbjct: 182 ggatggattccagataacttgaacaatggtcatcttgattactttttctggcttttagct 241

                                             
Query: 586 ggactcagtttcttaaacatgttggtgtacattg 619
           ||||| || |||||||| ||||||||||| ||||
Sbjct: 242 ggacttagcttcttaaatatgttggtgtatattg 275