Miyakogusa Predicted Gene

Lj4g3v0166160.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0166160.3 Non Chatacterized Hit- tr|I1K3A6|I1K3A6_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,76.21,0,PTR2,Proton-dependent oligopeptide transporter family; no
description,NULL; MFS general substrate tr,CUFF.46583.3
         (936 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS332924 similar to UniRef100_Q7XAC3 Cluster: Peptide t...   270   1e-71
gnl|LJGI|AW720047 similar to UniRef100_A7P436 Cluster: Chromosom...    56   4e-07

>gnl|LJGI|FS332924 similar to UniRef100_Q7XAC3 Cluster: Peptide transporter 1; n=1;
           Vicia faba|Rep: Peptide transporter 1 - Vicia faba
           (Broad bean), partial (18%)
          Length = 832

 Score =  270 bits (136), Expect = 1e-71
 Identities = 286/336 (85%)
 Strand = Plus / Plus

                                                                       
Query: 34  gaagagcctcttcttcaggatgaaggggacagtcaatacacaggagatggctcagttgac 93
           ||||||||||||||||||||||||| |  ||  | |||||||||||||||||||||||||
Sbjct: 277 gaagagcctcttcttcaggatgaagagagcaaacgatacacaggagatggctcagttgac 336

                                                                       
Query: 94  attagaggaaggcctgttcttaagcagaatactgggaattggaaagcatgcccctttatt 153
            ||| ||| || ||||||||||||||||||||||| | ||||||||| ||||| ||||| 
Sbjct: 337 tttaaagggagacctgttcttaagcagaatactggcacttggaaagcttgcccatttatc 396

                                                                       
Query: 154 ctaggcaatgaatgttgtgaacgtttagctttcttcggcattgcaacgaatcttgttacc 213
           |||||||||||||| ||||||||||| || | ||  || |||||||| ||||||||||||
Sbjct: 397 ctaggcaatgaatgctgtgaacgtttggcatactatggaattgcaacaaatcttgttacc 456

                                                                       
Query: 214 tatcttaccaccaaattacatcaagaaaacgtctctgctgcgagaaatgtcagcatctgg 273
           |||||||||   ||| |||| ||||  || ||| ||||||| |||||||||| ||  |||
Sbjct: 457 tatcttacccaaaaactacaccaagggaatgtcgctgctgcaagaaatgtcaccacttgg 516

                                                                       
Query: 274 caaggcacttgttatcttacgcctctcattgcagctgttcttgcagatggttattgggga 333
           |||||||| ||||||||| | |||||||||| |||| |||| ||||||  ||  ||||||
Sbjct: 517 caaggcacatgttatcttgcacctctcattggagctattctagcagattcttgctgggga 576

                                               
Query: 334 cgatactggacaattgctgttttctctatgatttat 369
           ||||||||||| ||||| |||||||| | |||||||
Sbjct: 577 cgatactggactattgcagttttctccacgatttat 612


>gnl|LJGI|AW720047 similar to UniRef100_A7P436 Cluster: Chromosome chr1 scaffold_5,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_5, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (21%)
          Length = 419

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 133 tggaaagcatgcccctttattctaggca 160
           ||||||||||||||||||||||||||||
Sbjct: 6   tggaaagcatgcccctttattctaggca 33