Miyakogusa Predicted Gene

Lj4g3v0153870.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0153870.1 Non Chatacterized Hit- tr|B9SAC3|B9SAC3_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,34.88,0.000000002,coiled-coil,NULL; seg,NULL,CUFF.46572.1
         (391 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66258                                                       56   2e-07

>gnl|LJGI|TC66258 
          Length = 767

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 97/120 (80%)
 Strand = Plus / Plus

                                                                       
Query: 102 caaggtgtttgatgaaggtcatgcgttgagtttacggaacgtgccgaaggagaagcttct 161
           ||||||||||||||||||||| | |||||||||  ||||||||  || ||||||| |  |
Sbjct: 214 caaggtgtttgatgaaggtcaggggttgagtttggggaacgtggagagggagaaggtgat 273

                                                                       
Query: 162 gggagcactgaaaagttcttgtgatgcaaatgggaaggtgaagattaagatgtcaaagaa 221
            |||    ||| |  ||||| ||||||  |||||||||||||||||||||| || |||||
Sbjct: 274 aggaatgttgagagcttcttctgatgctgatgggaaggtgaagattaagatttccaagaa 333