Miyakogusa Predicted Gene

Lj4g3v0151580.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0151580.1 Non Chatacterized Hit- tr|J3MR14|J3MR14_ORYBR
Uncharacterized protein OS=Oryza brachyantha
GN=OB08G1,30.54,0.0000001,CBM_25,Carbohydrate binding module family
25; Carbohydrate binding domain,Carbohydrate binding
modul,CUFF.46536.1
         (660 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75479 similar to UniRef100_Q9XGC0 Cluster: Starch syn...    62   5e-09

>gnl|LJGI|TC75479 similar to UniRef100_Q9XGC0 Cluster: Starch synthase isoform SS
           III; n=1; Vigna unguiculata|Rep: Starch synthase isoform
           SS III - Vigna unguiculata (Cowpea), partial (15%)
          Length = 764

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 576 gctgatatacagaaaactccaggagcataggaggttaagagag 618
           |||||||||||||||||| |||||| |||||| ||||||||||
Sbjct: 1   gctgatatacagaaaacttcaggaggataggaagttaagagag 43