Miyakogusa Predicted Gene

Lj4g3v0134610.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0134610.3 Non Chatacterized Hit- tr|I1KNG6|I1KNG6_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,88.09,0,leuS_bact:
leucine--tRNA ligase,Leucine-tRNA ligase, bacterial/mitochondrial;
Nucleotidylyl transfer,CUFF.46506.3
         (2625 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71292                                                       62   2e-08

>gnl|LJGI|TC71292 
          Length = 514

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                               
Query: 1186 attccaatatgggtggcagattatgttttggggag 1220
            ||||||||||||||| |||||||||||||||||||
Sbjct: 189  attccaatatgggtgccagattatgttttggggag 223