Miyakogusa Predicted Gene

Lj4g3v0134610.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0134610.1 Non Chatacterized Hit- tr|I1KNG6|I1KNG6_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,93.55,0,ValRS/IleRS/LeuRS editing
domain,Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing
domain; N,CUFF.46506.1
         (1239 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71292                                                       62   9e-09

>gnl|LJGI|TC71292 
          Length = 514

 Score = 61.9 bits (31), Expect = 9e-09
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 409 attccaatatgggtggcagattatgttttggggag 443
           ||||||||||||||| |||||||||||||||||||
Sbjct: 189 attccaatatgggtgccagattatgttttggggag 223