Miyakogusa Predicted Gene

Lj4g3v0120340.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0120340.1 Non Chatacterized Hit- tr|I1KNI3|I1KNI3_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,97.27,0,TYRKINASE,Serine-threonine/tyrosine-protein kinase
catalytic domain; Serine/Threonine protein kinase,gene.g51598.t1.1
         (786 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62375 homologue to UniRef100_Q9AWA6 Cluster: Serine/t...    58   9e-08

>gnl|LJGI|TC62375 homologue to UniRef100_Q9AWA6 Cluster: Serine/threonine/tyrosine
            kinase; n=1; Arachis hypogaea|Rep:
            Serine/threonine/tyrosine kinase - Arachis hypogaea
            (Peanut), partial (98%)
          Length = 1789

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 607  ggaacatatcgttggatggcaccagagatgattaaggaaaagccttacactcggaaagtt 666
            |||||||| ||||||||||| || ||||||||  |  | | ||||||||| |  ||||| 
Sbjct: 1118 ggaacataccgttggatggccccggagatgatccaacataggccttacacacaaaaagtg 1177

                                                 
Query: 667  gatgtctatagctttggaattgtgctttgggaactca 703
            ||||| ||||||||||| ||||| || ||||||||||
Sbjct: 1178 gatgtatatagctttgggattgttctgtgggaactca 1214