Miyakogusa Predicted Gene

Lj4g3v0073820.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v0073820.1 Non Chatacterized Hit- tr|G7ISR7|G7ISR7_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,80.49,0.000000002,
,NODE_106114_length_96_cov_17.791666.path1.1
         (124 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80113 similar to UniRef100_Q107V4 Cluster: ATPase sub...   246   2e-65
gnl|LJGI|TC62650 UniRef100_P12347 Cluster: Period clock protein;...   198   5e-51

>gnl|LJGI|TC80113 similar to UniRef100_Q107V4 Cluster: ATPase subunit 6; n=1;
           Nesomimus melanotis|Rep: ATPase subunit 6 - Nesomimus
           melanotis (San Cristobal mockingbird), partial (8%)
          Length = 671

 Score =  246 bits (124), Expect = 2e-65
 Identities = 124/124 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 670 atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 611

                                                                       
Query: 61  tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 610 tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 551

               
Query: 121 attt 124
           ||||
Sbjct: 550 attt 547


>gnl|LJGI|TC62650 UniRef100_P12347 Cluster: Period clock protein; n=1; Acetabularia
            acetabulum|Rep: Period clock protein - Acetabularia
            acetabulum (Mermaid's wine glass)
            (Acetabulariamediterranea), partial (8%)
          Length = 1600

 Score =  198 bits (100), Expect = 5e-51
 Identities = 118/124 (95%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 60
            |||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
Sbjct: 1179 atgaacactaggattgcaaatgaatccagtcaggaatctatatttagcccagagctggta 1238

                                                                        
Query: 61   tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 120
            ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1239 tctgcctttgaacagtgcatgcaaaatcttgatgcagaggaagaaaagattttgaaacaa 1298

                
Query: 121  attt 124
            ||||
Sbjct: 1299 attt 1302