Miyakogusa Predicted Gene
- Lj4g3v0072430.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v0072430.1 tr|Q2HSS4|Q2HSS4_MEDTR MLO-like protein
OS=Medicago truncatula GN=MtrDRAFT_AC151000g8v2 PE=3
SV=1,70.93,0,seg,NULL; Mlo,Mlo-related protein; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT
NAMED,NULL,NODE_43168_length_1572_cov_9.791348.path1.1
(1446 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC57745 similar to UniRef100_O49621 Cluster: MLO-like p... 54 3e-06
>gnl|LJGI|TC57745 similar to UniRef100_O49621 Cluster: MLO-like protein 1; n=1;
Arabidopsis thaliana|Rep: MLO-like protein 1 -
Arabidopsis thaliana (Mouse-ear cress), partial (78%)
Length = 2029
Score = 54.0 bits (27), Expect = 3e-06
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 1108 ttctggatttggagcacatatggatttgattcatgcattatgg 1150
|||||||||||| |||||||||||||||||| ||||| ||||
Sbjct: 1349 ttctggatttgggtcacatatggatttgattcctgcataatgg 1391