Miyakogusa Predicted Gene

Lj3g3v3736640.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3736640.1 tr|G7LBX4|G7LBX4_MEDTR Leucine-rich repeat
receptor-like protein kinase PEPR2 OS=Medicago
truncatula,62.91,0,seg,NULL,CUFF.46250.1
         (1788 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80471 similar to UniRef100_A4TTL5 Cluster: Membrane p...   563   e-159

>gnl|LJGI|TC80471 similar to UniRef100_A4TTL5 Cluster: Membrane protein; n=1;
            Magnetospirillum gryphiswaldense|Rep: Membrane protein -
            Magnetospirillum gryphiswaldense, partial (5%)
          Length = 833

 Score =  563 bits (284), Expect = e-159
 Identities = 287/288 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1501 gataaggaaaggagagagagggcatgcagatctcgattgcaaagtctttgggccccaaaa 1560
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2    gataaggaaaggagagagagggcatgcagatctcgattgcaaagtctttgggccccaaaa 61

                                                                        
Query: 1561 cagaatggtgtgaaactcaagacagatcacctccaaaagctgccaaaaaggaaggagcga 1620
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62   cagaatggtgtgaaactcaagacagatcacctccaaaagctgccaaaaaggaaggagcga 121

                                                                        
Query: 1621 ccaagggcaagctatgacacagtatgtgagacgccaatgacaagaaacaagcgatcaagc 1680
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122  ccaagggcaagctatgacacagtatgtgagacgccaatgacaagaaacaagcgatcaagc 181

                                                                        
Query: 1681 caatgtacgagggactgggaatatgacagtcgcctggctgatgggagtccttcatgtggc 1740
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 182  caatgtacgagggactgggaatatgacagtcgcctggctgatgggagtccttcatgtggc 241

                                                            
Query: 1741 tcagtttctaaggcattgtttcaggatgatcttggatgtgattaaacc 1788
            ||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 242  tcagtttctaaggcattgtttcaggatgatctttgatgtgattaaacc 289