Miyakogusa Predicted Gene
- Lj3g3v3700150.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3700150.1 Non Chatacterized Hit- tr|I1LNV9|I1LNV9_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.8818
PE=,58.27,0,seg,NULL; coiled-coil,NULL,CUFF.46356.1
(1470 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66829 153 4e-36
>gnl|LJGI|TC66829
Length = 589
Score = 153 bits (77), Expect = 4e-36
Identities = 77/77 (100%)
Strand = Plus / Plus
Query: 1394 ctcaaatattcccaggtcttgtagttacagctcctgagttttctgatgatgaggatgagg 1453
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ctcaaatattcccaggtcttgtagttacagctcctgagttttctgatgatgaggatgagg 60
Query: 1454 ttgataatgcatcggga 1470
|||||||||||||||||
Sbjct: 61 ttgataatgcatcggga 77