Miyakogusa Predicted Gene

Lj3g3v3689920.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3689920.1 Non Chatacterized Hit- tr|C6SWL9|C6SWL9_SOYBN
Putative uncharacterized protein OS=Glycine max PE=4 S,58,0.000004,
,CUFF.46192.1
         (237 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65026 weakly similar to UniRef100_Q6IM91 Cluster: DVL...   470   e-132

>gnl|LJGI|TC65026 weakly similar to UniRef100_Q6IM91 Cluster: DVL10; n=1; Arabidopsis
           thaliana|Rep: DVL10 - Arabidopsis thaliana (Mouse-ear
           cress), partial (76%)
          Length = 774

 Score =  470 bits (237), Expect = e-132
 Identities = 237/237 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggtcgtgccagcagaggagcatggttatgcaacgtcccaagatgtagaaacgcgtctt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 atggtcgtgccagcagaggagcatggttatgcaacgtcccaagatgtagaaacgcgtctt 188

                                                                       
Query: 61  ctggtgcttggcgacctggaaacaccgttttcggaggctggttttacggcgaggttggga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 ctggtgcttggcgacctggaaacaccgttttcggaggctggttttacggcgaggttggga 128

                                                                       
Query: 121 tttggaagtgaacacggagagagtcatggttggaaggaaggaagagtgagtaacagaaat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 tttggaagtgaacacggagagagtcatggttggaaggaaggaagagtgagtaacagaaat 68

                                                                    
Query: 181 cggaaacttgagaacgtgttctggtatttgcaggggacagaggctgttgaattgaag 237
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67  cggaaacttgagaacgtgttctggtatttgcaggggacagaggctgttgaattgaag 11