Miyakogusa Predicted Gene
- Lj3g3v3651380.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3651380.1 tr|G7JUR7|G7JUR7_MEDTR Calcium-transporting
ATPase 4, plasma membrane-type OS=Medicago truncatula
GN,95.65,0,HAD-like,HAD-like domain; Calcium ATPase, transmembrane
domain M,NULL; ATPase_P-type: HAD ATPase, P-,CUFF.46151.1
(624 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67673 homologue to UniRef100_Q8L8A0 Cluster: Type IIB... 159 3e-38
gnl|LJGI|TC82735 homologue to UniRef100_Q9FVE8 Cluster: Plasma m... 101 5e-21
gnl|LJGI|TC78106 similar to UniRef100_Q93YX7 Cluster: Type IIB c... 66 3e-10
gnl|LJGI|TC78231 similar to UniRef100_Q8W0V0 Cluster: Type IIB c... 60 2e-08
>gnl|LJGI|TC67673 homologue to UniRef100_Q8L8A0 Cluster: Type IIB calcium ATPase
MCA5; n=1; Medicago truncatula|Rep: Type IIB calcium
ATPase MCA5 - Medicago truncatula (Barrel medic),
partial (27%)
Length = 840
Score = 159 bits (80), Expect = 3e-38
Identities = 188/224 (83%)
Strand = Plus / Plus
Query: 208 gaagttgtggcagtaactggtgatgggaccaacgatgctccagcgttgcatgaggctgat 267
|||||||| || |||||||||||||| || || ||||| ||||| ||||||| || |||
Sbjct: 430 gaagttgtagctgtaactggtgatggaacaaatgatgccccagccctgcatgaagcagat 489
Query: 268 attggacttgctatgggcattgctggaactgaggtagcaaaagagaatgctgatgtgatt 327
||||||||||| ||||||||||||||||||||||| |||||||| | ||| ||||| ||
Sbjct: 490 attggacttgcaatgggcattgctggaactgaggttgcaaaagaaagtgcagatgtcata 549
Query: 328 gtaatggatgataacttcgccaccatagtgaatgttgccagatggggtcgttctgtttac 387
|| |||||||||||||| |||| ||||| | || |||| |||||| ||||| ||||||
Sbjct: 550 atattggatgataacttctccacaatagtaacagtggccaaatggggacgttcagtttac 609
Query: 388 attaacatacaaaaatttgtccagttccagttaacagttaatgt 431
|| || || || ||||| || ||||||||| | |||||||||||
Sbjct: 610 ataaatattcagaaattcgtgcagttccagctgacagttaatgt 653
>gnl|LJGI|TC82735 homologue to UniRef100_Q9FVE8 Cluster: Plasma membrane Ca2+-ATPase;
n=1; Glycine max|Rep: Plasma membrane Ca2+-ATPase -
Glycine max (Soybean), partial (24%)
Length = 819
Score = 101 bits (51), Expect = 5e-21
Identities = 84/95 (88%)
Strand = Plus / Plus
Query: 208 gaagttgtggcagtaactggtgatgggaccaacgatgctccagcgttgcatgaggctgat 267
|||||||| || |||||||||||||| || || ||||| ||||| ||||||| || |||
Sbjct: 723 gaagttgtagctgtaactggtgatggaacaaatgatgccccagccctgcatgaagcagat 782
Query: 268 attggacttgctatgggcattgctggaactgaggt 302
||||||||||| |||||||||||||||||||||||
Sbjct: 783 attggacttgcaatgggcattgctggaactgaggt 817
>gnl|LJGI|TC78106 similar to UniRef100_Q93YX7 Cluster: Type IIB calcium ATPase; n=1;
Medicago truncatula|Rep: Type IIB calcium ATPase -
Medicago truncatula (Barrel medic), partial (24%)
Length = 749
Score = 65.9 bits (33), Expect = 3e-10
Identities = 51/57 (89%)
Strand = Plus / Plus
Query: 289 gctggaactgaggtagcaaaagagaatgctgatgtgattgtaatggatgataacttc 345
|||||||||||||| || ||||| ||||||||||| ||| ||||||| |||||||||
Sbjct: 4 gctggaactgaggttgccaaagaaaatgctgatgtcattataatggacgataacttc 60
>gnl|LJGI|TC78231 similar to UniRef100_Q8W0V0 Cluster: Type IIB calcium ATPase; n=1;
Medicago truncatula|Rep: Type IIB calcium ATPase -
Medicago truncatula (Barrel medic), partial (22%)
Length = 942
Score = 60.0 bits (30), Expect = 2e-08
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 475 tctgctcctcttactgctgttcaaatgctttgggtgaatatgatcatggacactctagga 534
|||||||| || || |||||||| |||||||||| || |||| ||||||||||| ||
Sbjct: 67 tctgctccactcacagctgttcagttgctttgggtcaacttgattatggacactcttggt 126
Query: 535 gcattggcattggctacagaacctcc 560
||||| || |||||||| ||||||||
Sbjct: 127 gcattagccttggctactgaacctcc 152