Miyakogusa Predicted Gene

Lj3g3v3651380.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3651380.1 tr|G7JUR7|G7JUR7_MEDTR Calcium-transporting
ATPase 4, plasma membrane-type OS=Medicago truncatula
GN,95.65,0,HAD-like,HAD-like domain; Calcium ATPase, transmembrane
domain M,NULL; ATPase_P-type: HAD ATPase, P-,CUFF.46151.1
         (624 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67673 homologue to UniRef100_Q8L8A0 Cluster: Type IIB...   159   3e-38
gnl|LJGI|TC82735 homologue to UniRef100_Q9FVE8 Cluster: Plasma m...   101   5e-21
gnl|LJGI|TC78106 similar to UniRef100_Q93YX7 Cluster: Type IIB c...    66   3e-10
gnl|LJGI|TC78231 similar to UniRef100_Q8W0V0 Cluster: Type IIB c...    60   2e-08

>gnl|LJGI|TC67673 homologue to UniRef100_Q8L8A0 Cluster: Type IIB calcium ATPase
           MCA5; n=1; Medicago truncatula|Rep: Type IIB calcium
           ATPase MCA5 - Medicago truncatula (Barrel medic),
           partial (27%)
          Length = 840

 Score =  159 bits (80), Expect = 3e-38
 Identities = 188/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 208 gaagttgtggcagtaactggtgatgggaccaacgatgctccagcgttgcatgaggctgat 267
           |||||||| || |||||||||||||| || || ||||| |||||  ||||||| || |||
Sbjct: 430 gaagttgtagctgtaactggtgatggaacaaatgatgccccagccctgcatgaagcagat 489

                                                                       
Query: 268 attggacttgctatgggcattgctggaactgaggtagcaaaagagaatgctgatgtgatt 327
           ||||||||||| ||||||||||||||||||||||| |||||||| | ||| ||||| || 
Sbjct: 490 attggacttgcaatgggcattgctggaactgaggttgcaaaagaaagtgcagatgtcata 549

                                                                       
Query: 328 gtaatggatgataacttcgccaccatagtgaatgttgccagatggggtcgttctgtttac 387
            || |||||||||||||| |||| ||||| |  || |||| |||||| ||||| ||||||
Sbjct: 550 atattggatgataacttctccacaatagtaacagtggccaaatggggacgttcagtttac 609

                                                       
Query: 388 attaacatacaaaaatttgtccagttccagttaacagttaatgt 431
           || || || || ||||| || ||||||||| | |||||||||||
Sbjct: 610 ataaatattcagaaattcgtgcagttccagctgacagttaatgt 653


>gnl|LJGI|TC82735 homologue to UniRef100_Q9FVE8 Cluster: Plasma membrane Ca2+-ATPase;
           n=1; Glycine max|Rep: Plasma membrane Ca2+-ATPase -
           Glycine max (Soybean), partial (24%)
          Length = 819

 Score =  101 bits (51), Expect = 5e-21
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 208 gaagttgtggcagtaactggtgatgggaccaacgatgctccagcgttgcatgaggctgat 267
           |||||||| || |||||||||||||| || || ||||| |||||  ||||||| || |||
Sbjct: 723 gaagttgtagctgtaactggtgatggaacaaatgatgccccagccctgcatgaagcagat 782

                                              
Query: 268 attggacttgctatgggcattgctggaactgaggt 302
           ||||||||||| |||||||||||||||||||||||
Sbjct: 783 attggacttgcaatgggcattgctggaactgaggt 817


>gnl|LJGI|TC78106 similar to UniRef100_Q93YX7 Cluster: Type IIB calcium ATPase; n=1;
           Medicago truncatula|Rep: Type IIB calcium ATPase -
           Medicago truncatula (Barrel medic), partial (24%)
          Length = 749

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 289 gctggaactgaggtagcaaaagagaatgctgatgtgattgtaatggatgataacttc 345
           |||||||||||||| || ||||| ||||||||||| ||| ||||||| |||||||||
Sbjct: 4   gctggaactgaggttgccaaagaaaatgctgatgtcattataatggacgataacttc 60


>gnl|LJGI|TC78231 similar to UniRef100_Q8W0V0 Cluster: Type IIB calcium ATPase; n=1;
           Medicago truncatula|Rep: Type IIB calcium ATPase -
           Medicago truncatula (Barrel medic), partial (22%)
          Length = 942

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 475 tctgctcctcttactgctgttcaaatgctttgggtgaatatgatcatggacactctagga 534
           |||||||| || || ||||||||  |||||||||| ||  |||| ||||||||||| || 
Sbjct: 67  tctgctccactcacagctgttcagttgctttgggtcaacttgattatggacactcttggt 126

                                     
Query: 535 gcattggcattggctacagaacctcc 560
           ||||| || |||||||| ||||||||
Sbjct: 127 gcattagccttggctactgaacctcc 152