Miyakogusa Predicted Gene

Lj3g3v3650370.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3650370.1 CUFF.46150.1
         (1779 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV409404 similar to UniRef100_Q93YX7 Cluster: Type IIB ...    76   8e-13
gnl|LJGI|BP066255 homologue to UniRef100_Q8L8A0 Cluster: Type II...    74   3e-12

>gnl|LJGI|AV409404 similar to UniRef100_Q93YX7 Cluster: Type IIB calcium ATPase; n=1;
            Medicago truncatula|Rep: Type IIB calcium ATPase -
            Medicago truncatula (Barrel medic), partial (13%)
          Length = 421

 Score = 75.8 bits (38), Expect = 8e-13
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1319 ctgcatgtgagacaatgggttctgctggttgcatttgcacagacaagactgggactttaa 1378
            ||||||||||||| |||||||| |||  ||||||||||||||| || || ||||| || |
Sbjct: 65   ctgcatgtgagactatgggttcagctaattgcatttgcacagataaaacagggacattga 124

                                                  
Query: 1379 ctacaaatcacagggttgtagataaaatatggatttgc 1416
            ||||||| || | ||| || |||||||| |||||||||
Sbjct: 125  ctacaaaccatatggtggttgataaaatttggatttgc 162


>gnl|LJGI|BP066255 homologue to UniRef100_Q8L8A0 Cluster: Type IIB calcium ATPase MCA5;
            n=1; Medicago truncatula|Rep: Type IIB calcium ATPase
            MCA5 - Medicago truncatula (Barrel medic), partial (17%)
          Length = 540

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 97/117 (82%)
 Strand = Plus / Plus

                                                                        
Query: 961  gttggtatgagaactgaatggggaaggttgatggcaactctgaatgaaggaggagatgat 1020
            ||||| ||||| ||| ||||||| | ||||||||| ||||| | |||||| || ||||||
Sbjct: 53   gttggaatgaggactcaatggggcaagttgatggctactctcactgaaggcggggatgat 112

                                                                     
Query: 1021 gagacaccccttcaggttaaattgaatggggttgcaaccattattggaaaaataggc 1077
            || || ||  | ||||| ||||||||||| || |||||||||||||| || ||||||
Sbjct: 113  gaaaccccattacaggtgaaattgaatggagtggcaaccattattgggaagataggc 169