Miyakogusa Predicted Gene

Lj3g3v3639640.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3639640.1 Non Chatacterized Hit- tr|I1LIH3|I1LIH3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75,0,no
description,NULL; seg,NULL; Acetyl-CoA synthetase-like,NULL; SUBFAMILY
NOT NAMED,NULL; FAMILY NOT,CUFF.46082.1
         (757 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS350112 similar to UniRef100_P31687 Cluster: 4-coumara...   507   e-143
gnl|LJGI|TC76024 similar to UniRef100_P31687 Cluster: 4-coumarat...   151   7e-36
gnl|LJGI|TC76208 homologue to UniRef100_Q8S5C2 Cluster: 4-coumar...   143   2e-33
gnl|LJGI|TC76664 similar to UniRef100_Q8S5C2 Cluster: 4-coumarat...    70   2e-11

>gnl|LJGI|FS350112 similar to UniRef100_P31687 Cluster: 4-coumarate--CoA ligase 2;
           n=1; Glycine max|Rep: 4-coumarate--CoA ligase 2 -
           Glycine max (Soybean), partial (36%)
          Length = 630

 Score =  507 bits (256), Expect = e-143
 Identities = 256/256 (100%)
 Strand = Plus / Minus

                                                                       
Query: 436 tgcgcgctgagggcggggagcgcgatcatggtggtggagaggttcgagattaaggctctg 495
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 tgcgcgctgagggcggggagcgcgatcatggtggtggagaggttcgagattaaggctctg 571

                                                                       
Query: 496 ctggaggggatagagagggagagagtgacggtggcgatggtagtgccgccgatggtggtg 555
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 ctggaggggatagagagggagagagtgacggtggcgatggtagtgccgccgatggtggtg 511

                                                                       
Query: 556 gcgctggcgaaggacccgagggtggaggagtatgacctcagctccatacggttggtgatg 615
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 gcgctggcgaaggacccgagggtggaggagtatgacctcagctccatacggttggtgatg 451

                                                                       
Query: 616 tcaggggctgcgccgctggggaaggacctggaggatgctctccggagccggttgcctcgc 675
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 tcaggggctgcgccgctggggaaggacctggaggatgctctccggagccggttgcctcgc 391

                           
Query: 676 gcagttttgggacagg 691
           ||||||||||||||||
Sbjct: 390 gcagttttgggacagg 375


>gnl|LJGI|TC76024 similar to UniRef100_P31687 Cluster: 4-coumarate--CoA ligase 2;
           n=1; Glycine max|Rep: 4-coumarate--CoA ligase 2 -
           Glycine max (Soybean), partial (36%)
          Length = 729

 Score =  151 bits (76), Expect = 7e-36
 Identities = 148/172 (86%)
 Strand = Plus / Plus

                                                                       
Query: 524 cggtggcgatggtagtgccgccgatggtggtggcgctggcgaaggacccgagggtggagg 583
           ||||||| ||||| ||||||||| | ||| |||| ||||||||| | |||| ||||| ||
Sbjct: 480 cggtggccatggtggtgccgccgctagtgctggctctggcgaagaatccgaaggtggcgg 539

                                                                       
Query: 584 agtatgacctcagctccatacggttggtgatgtcaggggctgcgccgctggggaaggacc 643
           ||| |||||| ||||||||| |||||||| |||||||||||||||| || |||||||| |
Sbjct: 540 agtttgacctgagctccataaggttggtgctgtcaggggctgcgcctctcgggaaggagc 599

                                                               
Query: 644 tggaggatgctctccggagccggttgcctcgcgcagttttgggacaggtgag 695
           | ||||| |||||||||||| || ||||||  || |||||||||||||||||
Sbjct: 600 tcgaggaagctctccggagcagggtgcctcaagctgttttgggacaggtgag 651


>gnl|LJGI|TC76208 homologue to UniRef100_Q8S5C2 Cluster: 4-coumarate:CoA ligase
           isoenzyme 3; n=1; Glycine max|Rep: 4-coumarate:CoA
           ligase isoenzyme 3 - Glycine max (Soybean), partial
           (31%)
          Length = 527

 Score =  143 bits (72), Expect = 2e-33
 Identities = 144/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 524 cggtggcgatggtagtgccgccgatggtggtggcgctggcgaaggacccgagggtggagg 583
           ||||||| ||||| ||||||||| | ||| |||| ||||||||| | |||| ||||| ||
Sbjct: 79  cggtggccatggtggtgccgccgctagtgctggctctggcgaagaatccgaaggtggcgg 138

                                                                       
Query: 584 agtatgacctcagctccatacggttggtgatgtcaggggctgcgccgctggggaaggacc 643
           ||| |||||| ||||||||| |||||||| |||||||||||||||| || |||||||| |
Sbjct: 139 agtttgacctgagctccataaggttggtgctgtcaggggctgcgcctctcgggaaggagc 198

                                                           
Query: 644 tggaggatgctctccggagccggttgcctcgcgcagttttgggacagg 691
           | ||||| |||||||||||| || ||||||  || |||||||||||||
Sbjct: 199 tcgaggaagctctccggagcagggtgcctcaagctgttttgggacagg 246


>gnl|LJGI|TC76664 similar to UniRef100_Q8S5C2 Cluster: 4-coumarate:CoA ligase
           isoenzyme 3; n=1; Glycine max|Rep: 4-coumarate:CoA
           ligase isoenzyme 3 - Glycine max (Soybean), partial
           (19%)
          Length = 570

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                      
Query: 5   tcggcgccgtcgccaccaccgccaatccattctacaccaccgc 47
           ||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 518 tcggcgccgtcgccaccaccgccaacccgttctacaccaccgc 560