Miyakogusa Predicted Gene
- Lj3g3v3527560.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3527560.1 tr|Q9ZR62|Q9ZR62_VICFA Amino acid transporter
OS=Vicia faba PE=2
SV=1,85.11,0.000000000000004,PROKAR_LIPOPROTEIN,NULL,CUFF.45957.1
(142 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66602 similar to UniRef100_Q9ARG2 Cluster: Amino acid... 266 3e-71
>gnl|LJGI|TC66602 similar to UniRef100_Q9ARG2 Cluster: Amino acid transporter; n=1;
Glycine max|Rep: Amino acid transporter - Glycine max
(Soybean), partial (27%)
Length = 612
Score = 266 bits (134), Expect = 3e-71
Identities = 140/142 (98%)
Strand = Plus / Plus
Query: 1 atgtacatctcacaaaagaagattggaagatggagtaatcggtggcttggacttcagatg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 atgtacatctcacaaaagaagattggaagatggagtaatcggtggcttggacttcagatg 320
Query: 61 cttagtgtcagttgcctcatcatttcaatgttagctgctattggctctgtggctggtgtt 120
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 321 cttagtgtcagttgcctcatcatttcattgttagctgctgttggctctgtggctggtgtt 380
Query: 121 gttttggatctcaagactttca 142
||||||||||||||||||||||
Sbjct: 381 gttttggatctcaagactttca 402