Miyakogusa Predicted Gene

Lj3g3v3408010.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3408010.1 Non Chatacterized Hit- tr|I1LSE9|I1LSE9_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,84.91,2e-19,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,gene.g50833.t1.1
         (165 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind...   123   3e-28
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu...   100   5e-21
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...    82   1e-15
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu...    80   5e-15
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind...    74   3e-13
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu...    60   4e-09
gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosom...    54   3e-07
gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome...    54   3e-07

>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
           Glycine max|Rep: Auxin-induced protein 6B - Glycine max
           (Soybean), complete
          Length = 494

 Score =  123 bits (62), Expect = 3e-28
 Identities = 104/118 (88%)
 Strand = Plus / Minus

                                                                       
Query: 3   gaagaggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgat 62
           |||||||||||| |||||  ||||||||||||  ||||||||||| ||||| ||||||| 
Sbjct: 275 gaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgag 216

                                                                     
Query: 63  tcaagctgaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
           ||||||||||||  | ||||||||||| ||||| |||||||| |||||||||||||||
Sbjct: 215 tcaagctgaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgc 158


>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (80%)
          Length = 528

 Score = 99.6 bits (50), Expect = 5e-21
 Identities = 98/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   gaagaggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgat 62
           |||| ||||||||||||| ||||||||| |||  ||||||||||| ||||| || ||   
Sbjct: 205 gaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagttactaca 264

                                                                 
Query: 63  tcaagctgaggaacaatttggatatgaccatccaatgggtggtctcacaattcc 116
           |||||| || ||| ||||||||||||| |||||||| |||||||||||||||||
Sbjct: 265 tcaagccgaagaagaatttggatatgatcatccaataggtggtctcacaattcc 318


>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score = 81.8 bits (41), Expect = 1e-15
 Identities = 92/109 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  tgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaagctga 71
           |||||||||||||||||| ||||  |||||   ||| |||| ||| || | |||||||||
Sbjct: 512 tgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctga 571

                                                            
Query: 72  ggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
           |||| | ||||||||||||||||  | |||||||||||| |||||||||
Sbjct: 572 ggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620


>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (90%)
          Length = 491

 Score = 79.8 bits (40), Expect = 5e-15
 Identities = 91/108 (84%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaag 67
           |||||||||| ||  ||||||||||||  |||||||| || ||||| || |||  |||||
Sbjct: 221 ggtttgtgattccagtatcatacttgaaccaaccttcttttcaagagttactgcatcaag 280

                                                           
Query: 68  ctgaggaacaatttggatatgaccatccaatgggtggtctcacaattc 115
           | || ||| ||||||||||||| |||||||  ||||||||||||||||
Sbjct: 281 cagaagaagaatttggatatgatcatccaacaggtggtctcacaattc 328


>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
           n=1; Glycine max|Rep: Auxin-induced protein 15A -
           Glycine max (Soybean), partial (90%)
          Length = 494

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 8   ggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaag 67
           |||||||||||||||| |||||| |||  ||||||||||| |||||  |  | |  ||||
Sbjct: 216 ggtttgtgatccccatttcatacctgaatcaaccttcatttcaagaactattaagccaag 275

                                                                
Query: 68  ctgaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
           |||| ||| |||  |||||||| |||||| ||||||||||| |||||||||||
Sbjct: 276 ctgaagaaaaatacggatatgatcatccagtgggtggtctcgcaattccttgc 328


>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (91%)
          Length = 523

 Score = 60.0 bits (30), Expect = 4e-09
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  tatcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttg 82
           ||||||||||||  ||||||||||| ||||| || ||   |||||| || ||| ||||||
Sbjct: 235 tatcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttg 294

                                             
Query: 83  gatatgaccatccaatgggtggtctcacaattcc 116
           ||||||| |||||||  || ||||||| ||||||
Sbjct: 295 gatatgatcatccaacaggcggtctcaaaattcc 328


>gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosome chr4 scaffold_32,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_32, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (67%)
          Length = 621

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 94  ccaatgggtggtctcacaattccttgc 120
           |||||||||||||||||||||||||||
Sbjct: 362 ccaatgggtggtctcacaattccttgc 388


>gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome chr3 scaffold_8,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr3 scaffold_8, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (64%)
          Length = 636

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 94  ccaatgggtggtctcacaattccttgc 120
           |||||||||||||||||||||||||||
Sbjct: 325 ccaatgggtggtctcacaattccttgc 351