Miyakogusa Predicted Gene
- Lj3g3v3408010.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3408010.1 Non Chatacterized Hit- tr|I1LSE9|I1LSE9_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,84.91,2e-19,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,gene.g50833.t1.1
(165 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 123 3e-28
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 100 5e-21
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 82 1e-15
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 80 5e-15
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 74 3e-13
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 60 4e-09
gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosom... 54 3e-07
gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome... 54 3e-07
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 123 bits (62), Expect = 3e-28
Identities = 104/118 (88%)
Strand = Plus / Minus
Query: 3 gaagaggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgat 62
|||||||||||| ||||| |||||||||||| ||||||||||| ||||| |||||||
Sbjct: 275 gaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaattgctgag 216
Query: 63 tcaagctgaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
|||||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||
Sbjct: 215 tcaagctgaggacgagtttggatatgatcatcccatgggtggcctcacaattccttgc 158
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 99.6 bits (50), Expect = 5e-21
Identities = 98/114 (85%)
Strand = Plus / Plus
Query: 3 gaagaggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgat 62
|||| ||||||||||||| ||||||||| ||| ||||||||||| ||||| || ||
Sbjct: 205 gaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagttactaca 264
Query: 63 tcaagctgaggaacaatttggatatgaccatccaatgggtggtctcacaattcc 116
|||||| || ||| ||||||||||||| |||||||| |||||||||||||||||
Sbjct: 265 tcaagccgaagaagaatttggatatgatcatccaataggtggtctcacaattcc 318
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 81.8 bits (41), Expect = 1e-15
Identities = 92/109 (84%)
Strand = Plus / Plus
Query: 12 tgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaagctga 71
|||||||||||||||||| |||| ||||| ||| |||| ||| || | |||||||||
Sbjct: 512 tgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaagctga 571
Query: 72 ggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
|||| | |||||||||||||||| | |||||||||||| |||||||||
Sbjct: 572 ggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 79.8 bits (40), Expect = 5e-15
Identities = 91/108 (84%)
Strand = Plus / Plus
Query: 8 ggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaag 67
|||||||||| || |||||||||||| |||||||| || ||||| || ||| |||||
Sbjct: 221 ggtttgtgattccagtatcatacttgaaccaaccttcttttcaagagttactgcatcaag 280
Query: 68 ctgaggaacaatttggatatgaccatccaatgggtggtctcacaattc 115
| || ||| ||||||||||||| ||||||| ||||||||||||||||
Sbjct: 281 cagaagaagaatttggatatgatcatccaacaggtggtctcacaattc 328
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 73.8 bits (37), Expect = 3e-13
Identities = 94/113 (83%)
Strand = Plus / Plus
Query: 8 ggtttgtgatccccatatcatacttgagacaaccttcattccaagacttgctgattcaag 67
|||||||||||||||| |||||| ||| ||||||||||| ||||| | | | ||||
Sbjct: 216 ggtttgtgatccccatttcatacctgaatcaaccttcatttcaagaactattaagccaag 275
Query: 68 ctgaggaacaatttggatatgaccatccaatgggtggtctcacaattccttgc 120
|||| ||| ||| |||||||| |||||| ||||||||||| |||||||||||
Sbjct: 276 ctgaagaaaaatacggatatgatcatccagtgggtggtctcgcaattccttgc 328
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 60.0 bits (30), Expect = 4e-09
Identities = 78/94 (82%)
Strand = Plus / Plus
Query: 23 tatcatacttgagacaaccttcattccaagacttgctgattcaagctgaggaacaatttg 82
|||||||||||| ||||||||||| ||||| || || |||||| || ||| ||||||
Sbjct: 235 tatcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttg 294
Query: 83 gatatgaccatccaatgggtggtctcacaattcc 116
||||||| ||||||| || ||||||| ||||||
Sbjct: 295 gatatgatcatccaacaggcggtctcaaaattcc 328
>gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosome chr4 scaffold_32,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr4 scaffold_32, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (67%)
Length = 621
Score = 54.0 bits (27), Expect = 3e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 94 ccaatgggtggtctcacaattccttgc 120
|||||||||||||||||||||||||||
Sbjct: 362 ccaatgggtggtctcacaattccttgc 388
>gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (64%)
Length = 636
Score = 54.0 bits (27), Expect = 3e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 94 ccaatgggtggtctcacaattccttgc 120
|||||||||||||||||||||||||||
Sbjct: 325 ccaatgggtggtctcacaattccttgc 351