Miyakogusa Predicted Gene
- Lj3g3v3315950.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3315950.1 Non Chatacterized Hit- tr|A5AN63|A5AN63_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,28.63,2e-17,DNA-binding pseudobarrel domain,DNA-binding
pseudobarrel domain; coiled-coil,NULL; B3,B3 DNA binding,CUFF.45554.1
(1143 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC71408 UniRef100_A2R4J9 Cluster: 60S ribosomal subunit... 70 3e-11
>gnl|LJGI|TC71408 UniRef100_A2R4J9 Cluster: 60S ribosomal subunit assembly/export
protein loc1; n=1; Aspergillus niger|Rep: 60S ribosomal
subunit assembly/export protein loc1 - Aspergillus niger,
partial (5%)
Length = 716
Score = 69.9 bits (35), Expect = 3e-11
Identities = 41/43 (95%)
Strand = Plus / Plus
Query: 1043 gggagaagggaggcagttctgggaccaaagctgaagatgcaga 1085
||||||||||||||||||||| |||||| ||||||||||||||
Sbjct: 106 gggagaagggaggcagttctgagaccaaggctgaagatgcaga 148
Score = 56.0 bits (28), Expect = 5e-07
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1043 gggagaagggaggcagttctgggaccaa 1070
||||||||||||||||||||||||||||
Sbjct: 43 gggagaagggaggcagttctgggaccaa 70