Miyakogusa Predicted Gene

Lj3g3v3261430.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3261430.1 Non Chatacterized Hit- tr|I1NEW4|I1NEW4_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,43.75,4e-16,zf-CCHC_4,Zinc knuckle CX2CX4HX4C; DUF4283,Domain of
unknown function DUF4283; ZF_CCHC,Zinc finger, ,CUFF.45535.1
         (348 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC597608                                                      56   1e-07

>gnl|LJGI|DC597608 
          Length = 446

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 62/72 (86%), Gaps = 1/72 (1%)
 Strand = Plus / Plus

                                                                       
Query: 189 gcaagggaaggagcttaaggtttatttcagatatgagaggcttcccaatttttgctttgc 248
           ||||||||| |||||| ||||||| |||| ||||||||||||| | ||||| ||||||| 
Sbjct: 342 gcaagggaatgagcttcaggtttacttca-atatgagaggctttctaatttatgctttga 400

                       
Query: 249 ttgcggaagaat 260
            ||||| |||||
Sbjct: 401 gtgcggtagaat 412