Miyakogusa Predicted Gene
- Lj3g3v3243150.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj3g3v3243150.1 Non Chatacterized Hit- tr|I1HYC6|I1HYC6_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,70,3e-19,HMA,Heavy metal-associated domain, HMA; no
description,NULL; HGSCAVENGER,Mercury scavenger protein; ,CUFF.45511.1
(211 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV770018 similar to UniRef100_A7NZT0 Cluster: Chromosom... 58 2e-08
>gnl|LJGI|AV770018 similar to UniRef100_A7NZT0 Cluster: Chromosome chr6 scaffold_3,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr6 scaffold_3, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (8%)
Length = 599
Score = 58.0 bits (29), Expect = 2e-08
Identities = 89/109 (81%)
Strand = Plus / Plus
Query: 7 tgcacgagttgctctcagtctgttgagcatgcccttcaaatgattgatggagtgaaaaaa 66
|||||||| || ||| ||||| ||||| |||| || |||||| ||||||| |||||||
Sbjct: 392 tgcacgagctgttctgagtctattgagaatgctctccaaatggttgatggggtgaaaagg 451
Query: 67 gcagtagtaggtctagctttagaggaagcaaaagtactcttcgatccta 115
|| |||| ||||| ||||||||||| || ||||| | ||| |||||||
Sbjct: 452 gcgatagttggtctggctttagaggaggcgaaagtgcactttgatccta 500