Miyakogusa Predicted Gene

Lj3g3v3243150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3243150.1 Non Chatacterized Hit- tr|I1HYC6|I1HYC6_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,70,3e-19,HMA,Heavy metal-associated domain, HMA; no
description,NULL; HGSCAVENGER,Mercury scavenger protein; ,CUFF.45511.1
         (211 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV770018 similar to UniRef100_A7NZT0 Cluster: Chromosom...    58   2e-08

>gnl|LJGI|AV770018 similar to UniRef100_A7NZT0 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (8%)
          Length = 599

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 7   tgcacgagttgctctcagtctgttgagcatgcccttcaaatgattgatggagtgaaaaaa 66
           |||||||| || ||| ||||| ||||| |||| || |||||| ||||||| |||||||  
Sbjct: 392 tgcacgagctgttctgagtctattgagaatgctctccaaatggttgatggggtgaaaagg 451

                                                            
Query: 67  gcagtagtaggtctagctttagaggaagcaaaagtactcttcgatccta 115
           ||  |||| ||||| ||||||||||| || ||||| | ||| |||||||
Sbjct: 452 gcgatagttggtctggctttagaggaggcgaaagtgcactttgatccta 500