Miyakogusa Predicted Gene

Lj3g3v3235480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v3235480.1 tr|D7L4E9|D7L4E9_ARALL Pentatricopeptide
repeat-containing protein OS=Arabidopsis lyrata subsp.
lyra,61.25,3e-19,PPR,Pentatricopeptide repeat; PPR_2,Pentatricopeptide
repeat; PPR: pentatricopeptide repeat domain,P,gene.g50482.t1.1
         (336 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76680 homologue to UniRef100_A7NYU6 Cluster: Chromoso...    62   2e-09

>gnl|LJGI|TC76680 homologue to UniRef100_A7NYU6 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (18%)
          Length = 496

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 67/75 (89%), Gaps = 3/75 (4%)
 Strand = Plus / Plus

                                                                       
Query: 254 acaaggactatttg-aagaggtttactca-gaac-cctcttcggcgcctcggagatcttg 310
           ||||||||||| || |||||||||||||  |||| |||||| ||||||||||||||| ||
Sbjct: 97  acaaggactatctggaagaggtttactctcgaactcctcttaggcgcctcggagatcctg 156

                          
Query: 311 aagaagtgtcttctc 325
            ||||||||||||||
Sbjct: 157 cagaagtgtcttctc 171